Labshake search
Citations for Bio-Synthesis :
1 - 4 of 4 citations for 6 FLUORO 4 METHYLCOUMARIN 3 CARBONITRIL& since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... 500 nM substrate RNA (5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3, Bio-Synthesis, Inc.), and 60 nM yDcpS at 37 °C for 60 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.2 µM the immobilized or solution form of SNAP-tagged FCE was incubated with 0.5 µM of a 5′ triphosphate 3′ FAM-labeled RNA oligonucleotide (ppp25-mer; Bio-synthesis Inc.) in reactions containing 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Biochemistry 2022Quote: ... composed of 5’ deoxynucleotides and 3’ ribonucleotides with or without a 3’ TEG-desthiobiotin group were designed as described in the main text and synthesized chemically (Integrated DNA Technologies or Bio-Synthesis, Inc). For the investigation of RNase H cleavage specificity ...