Labshake search
Citations for Biosearch Technologies :
1 - 38 of 38 citations for Rabbit Anti Human IgG gamma chain Alexa Fluor 680 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... CAG10 FISH probe labeled with Alexa Fluor 594 (Biosearch Technologies, #SS151541-01) was diluted to a working concentration of 380 ng/mL in FISH hybridization buffer (100 mg/mL dextran sulfate ...
-
bioRxiv - Immunology 2024Quote: ... 50 µg NP-CGG (Chicken Gamma Globulin, LGC Biosearch Technologies) precipitated in alum (Cedarlane) ...
-
bioRxiv - Immunology 2021Quote: ... with 50 μg of either chicken gamma globulin (CGG) or NP-CGG (BioSearch Technologies) with 25% Alum (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... or 50 ug of alum-precipitated 4-Hydroxy-3-nitrophenylacetyl (NP)-chicken gamma globulin (CGG) (Biosearch Technologies). For adoptive transfer experiments ...
-
bioRxiv - Immunology 2022Quote: Wt and TNS3 nc/nc littermates (8–12 weeks old) were immunized by intraperitoneal injection with 200 μg of 4-Hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG, Biosearch Technology) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: Mice (aged 2–6 months) were injected intraperitoneally with 50 μg of 4-hydroxy-3-nitrophenylacetyl conjugated to chicken gamma globulin (NP-CGG) (Biosearch Technologies) in Imject Alum (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... 10-to 18-week-old mice were injected intraperitoneally with 100 μg of alum-precipitated 4-hydroxy-3-nitrophenylacetyl (NP)-chicken-gamma-globulin (CCG) (Biosearch Technologies, Novato, CA) in 200 μl sterile PBS (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... Hybridization with CAL Fluor Red 610-conjugated anti-PEX14 mRNA FISH probes tiling the length of the PEX14 ORF (0.125 μM, Biosearch Technologies) was carried out overnight at 30°C in hybridization buffer (10% formamide ...
-
bioRxiv - Immunology 2021Quote: ... parisii ribosomal RNA conjugated to Cal Fluor 610 dye (Biosearch Technologies). For the 3 hpi timepoint ...
-
bioRxiv - Systems Biology 2020Quote: ... The probes were coupled to CAL Fluor Red 610 (Biosearch Technologies, Inc.).
-
bioRxiv - Cell Biology 2022Quote: Human MYC_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2066-5), human ACTB_intron with Quasar 570 dye (Biosearch Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... human ACTB_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2002-5), Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... parisii 18S rRNA (ctctcggcactccttcctg) conjugated to Cal Fluor Red 610 (LGC Biosearch Technologies) [32] ...
-
bioRxiv - Cell Biology 2020Quote: ... Both probe sets were labeled with CAL Fluor Red 590 Dye (Biosearch Technologies, Inc.). Samples were hybridized with the gag/gag-pol probe set according to the manufacturer’s instructions available online ...
-
bioRxiv - Molecular Biology 2020Quote: ... and GAPDH labeled with CAL Fluor® Red 610 (Stellaris®, LGC Biosearch Technologies). 48 oligonucleotides were selected for OAT ...
-
bioRxiv - Cell Biology 2020Quote: ... Ret-all probe library was coupled to Alexa594 (CAL Fluor Red 610, Stellaris, Biosearch Technologies); Ret-long probe library was coupled to Cy5 (Quasar 670 ...
-
bioRxiv - Immunology 2021Quote: ... Staining was performed with 1 µM Cal Fluor 610 conjugated pals-5 smFISH probes (Biosearch Technologies) in smFISH hybridization buffer (10% formamide ...
-
bioRxiv - Cell Biology 2023Quote: Probe design: DNA probes coupled to CAL Fluor Red 590 (Stellaris Biosearch Technologies, synthesized by BioCat) were used for smFISH ...
-
bioRxiv - Microbiology 2022Quote: ... parisii 18S rRNA-specific microB FISH probe (ctctcggcactccttcctg) conjugated to Cal Fluor Red 610 (LGC Biosearch Technologies) was used (27) ...
-
bioRxiv - Genomics 2023Quote: ... Meronts and sporoplasms were visualized using FISH probes conjugated to CAL Fluor Red 610 (LGC Biosearch Technologies). N ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
Testing models of mRNA localization reveals robustness regulated by reducing transport between cellsbioRxiv - Developmental Biology 2019Quote: ... Stellaris Olignoucleotide probes 20nt in length complementary to the gurken transcript (CG17610; 48 probes) conjugated to CAL Fluor Red 590 were obtained from Biosearch technologies. Labelled oocytes were mounted on slides in 70% Vectashield (Vector laboratories).
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were hybridized with Stellaris RNA FISH Probe sets labeled with Cal Fluor 610 or Quasar 670 (Biosearch Technologies, Inc.), following the manufacturer’s instructions available online at www.biosearchtech.com/stellarisprotocols ...
-
bioRxiv - Immunology 2022Quote: ... that were both conjugated to the red Cal Fluor 610 fluorophore and hybridize to either Orsay RNA1 or RNA2 genome segments (Biosearch Technologies). Samples were analyzed for Orsay virus infection using a AxioImager M1 compound microscope (Zeiss) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Immunology 2023Quote: ... Fixed worms were stained at 46 °C overnight using FISH probes conjugated to the red Cal Fluor 610 fluorophore (Biosearch Technologies), targeting microsporidia ribosomal RNA (81 ...
-
bioRxiv - Immunology 2023Quote: ... Fixed worms were washed and then stained at 46 °C overnight using FISH probes conjugated to the red Cal Fluor 610 fluorophore (Biosearch Technologies), targeting Orsay virus RNA1 and RNA2 (80 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3.75 pmol of StellarisTM RNA FISH probes (CAL Fluor red 610 probes targeting ymEGFP or cdc13, or Quasar 570 probes targeting mad1 or rpb1; Biosearch Technologies, LGC) were combined with 2 µL each salmon-sperm DNA (Life Technologies ...
-
bioRxiv - Genetics 2021Quote: ... The mock-treated or infected nematodes were hybridized with the Stellaris RNA FISH Probe set labeled with CAL Fluor® Red 590 Dye (Biosearch Technologies, Inc.), following the manufacturer’s instructions available online at www.biosearchtech.com/stellarisprotocols based on protocols by Raj et al ...
-
bioRxiv - Cell Biology 2023Quote: Xist RNA was detected with Stellaris® RNA FISH (Human XIST with Quasar® 570 Dye, Biosearch Technologies, SMF-2038-1) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Genomics 2023Quote: ... FLAPY probes were labeled with Cal Fluor 610 and FLAP X probes were labeled with Quasar 670 (Biosearch Technologies, BNS-5082 and FC-1065, respectively). All samples were imaged on a DeltaVision Elite inverted microscope described above ...
-
bioRxiv - Genomics 2021Quote: ... human ZBTB16 which were designed targeting the complete coding sequence of human ZBTB16 (GenBank: BC029812.1) using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner (version 4.2) ...
-
bioRxiv - Immunology 2023Quote: ... were coated with anti-Ig(H+L) (Biosearch Technologies) prior to culture [20 hr ...
-
bioRxiv - Immunology 2021Quote: ... and incubating with anti-Ki-67 or 4-hydroxy-3-nitrophenylacetyl conjugated to phycoerythrin (NP-PE) (Biosearch Technologies) in Perm/Wash buffer for 30 min ...