Labshake search
Citations for Biosearch Technologies :
1 - 31 of 31 citations for L Valine 2 13C 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and incubated with 110 µL Hybridization Buffer [99 µL Stellaris RNA FISH Hybridization Buffer (LGC Biosearch Technologies, SMF-HB1-10), 11 µL deionized formamide] containing 1.1 µL 12.5 µM vgRNA FISH probes for 4 hours at 37°C in the dark ...
-
bioRxiv - Immunology 2023Quote: ... were coated with anti-Ig(H+L) (Biosearch Technologies) prior to culture [20 hr ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Genomics 2023Quote: ... Next the samples were transformed into electrocompetent cells (Biosearch Technologies, 60242-2). One 0.1cm cuvette (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were washed with 2 mL of wash buffer A (LGC Biosearch Technologies) supplemented with 10% deionized formamide (Agilent ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were then washed with 2 mL of Wash buffer A (LGC Biosearch Technologies) at RT for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: The lysate was incubated with 2 U of RNase I (LGC Biosearch Technologies, low), 10 U of RNase I (high) ...
-
bioRxiv - Genomics 2019Quote: ... We then washed the coverslips with 2 mL of Wash buffer A (LGC Biosearch Technologies) at room temperature for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 smFISH probes were designed using Stellaris smFISH probe designer (Biosearch Technologies) available online at http://www.biosearchtech.com/stellaris-designer ...
-
bioRxiv - Microbiology 2021Quote: ... A final wash step was performed using Wash buffer B (Biosearch Technologies Cat# SMF-WB1-2) for 5 mins before mounting coverslips with ProLong Gold Anti-Fade reagent (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: 2-4 months old mice were immunized intraperitoneally with 100 μg of NP18-OVA (Biosearch technologies) in Imject Alum adjuvant (Thermo Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... slow-2 and pgl-1 using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Developmental Biology 2024Quote: ... and kl-2 exons were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc.) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Molecular Biology 2023Quote: ... All SSOs used are RNA oligonucleotides with 2’-O-methyl modifications and phosphorothioate backbones (LGC Biosearch Technologies; Risskov, Denmark) (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: HUDEP-2 cells were washed with PBS and DNA extracted using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and recovering for 90 minutes at 30 °C in 1 mL of Endura recovery media (Biosearch Technologies 60242-2). Cultures were then grown for 16 hours in 50 mL of 2xYT media with 100 µg/mL of carbenicillin ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent heat shock and were hybridized for 2 h at 38.5 °C in a humidity chamber with XIST Quasar 570 (125 nM; SMF-2038-1; BioSearch Technologies) in a hybridization buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... smFISH probes consisting of 20 nt oligonucleotides with 2 nt spacing were designed with Stellaris Probe Designer and synthesized by Biosearch Technologies. Probe sets complementary to cycB (CG3510 ...
-
bioRxiv - Microbiology 2021Quote: ... The abundance of SARS-CoV-2 genetic material was subsequently determined by quantitative PCR using a Taqman probe and primers (Biosearch Technologies). The primers and probe sequences for the were as recommended by BEI resources for compatability with synthetic RNA standards (# NR-52358).
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genomics 2024Quote: ... The assembled plasmid pool was purified and concentrated with AMPure XP SPRI Reagent and used for transformation of Electrocompetent Endura Cells (#60242-2, Biosearch Technologies) following manufacturer’s instructions and a previously published protocol47 ...
-
bioRxiv - Genomics 2024Quote: ... Purified ligations were electrotransformed by combining 5 µL of ligation and 25 µL of Endura electrocompetent cells (Biosearch Technologies 60242-2) in a 0.1 cm Gene Pulser cuvette (Biorad 1652083 ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were washed with Stellaris Wash Buffer A solution (2 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies SMF-WA1-60), 7 mL Nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 25 µl of 10 µg/ml NP-BSA in PBS (N-5050XL-10-BS with loading ratio of 2 or N-5050H-10-BS with loading ratio of 36, both Biosearch Technologies/BioCat) overnight at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... and stored at 4°C for several days. A lag-2 RNA probe set (Barkoulas et al. 2013) coupled to AF594 (Custom Stellaris Fish Probes, Biosearch Tech, Teddington UK) was resuspended in RNase-free TE buffer (pH8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of the TdT-labeled probes was added to 98 μL of Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10); 100 μL of this mixture was dotted onto the Parafilm in the humidifying chamber ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 genome equivalents were quantified in culture supernatant by RT-qPCR using 2019-nCoV CDC probe and Primer Kit for SARS-CoV-2 (Biosearch Technologies, KIT-nCoV-PP1-1000). Forward primer ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...