Labshake search
Citations for Biosearch Technologies :
1 - 5 of 5 citations for L Valine 13C5 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and incubated with 110 µL Hybridization Buffer [99 µL Stellaris RNA FISH Hybridization Buffer (LGC Biosearch Technologies, SMF-HB1-10), 11 µL deionized formamide] containing 1.1 µL 12.5 µM vgRNA FISH probes for 4 hours at 37°C in the dark ...
-
bioRxiv - Immunology 2023Quote: ... were coated with anti-Ig(H+L) (Biosearch Technologies) prior to culture [20 hr ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...