Labshake search
Citations for Biosearch Technologies :
1 - 38 of 38 citations for Cyanine2 NHS ester minimal dye since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Immunology 2020Quote: ... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
bioRxiv - Genetics 2020Quote: 4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
bioRxiv - Biophysics 2020Quote: ... BHQ-10 maleimide was prepared from BHQ-10 succinimidyl ester (Biosearch Technologies) as described for the related BHQ-3 molecule (36) ...
-
bioRxiv - Genomics 2022Quote: ... labelled with FAM dye (1:100, Biosearch Technologies) were used and the procedure was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Stellaris smFISH probes conjugated to Quasar 570 dye (LGC Biosearch Technologies) were designed against the coding region for each gene of interest using the Stellaris RNA FISH probe designer and stored at −20 °C as stock solutions of 25 μM in nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... parisii ribosomal RNA conjugated to Cal Fluor 610 dye (Biosearch Technologies). For the 3 hpi timepoint ...
-
bioRxiv - Cell Biology 2022Quote: Human MYC_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2066-5), human ACTB_intron with Quasar 570 dye (Biosearch Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... human ACTB_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2002-5), Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: Bovine XIST probes with the Quasar 570 Dye and HUWE1 probes with the Quasar 670 Dye were purchased from Biosearch Technologies (SMF-1063-5 and SMF-1065-5). Cell fixation and hybridization were performed by following manufacture’s recommended protocols.
-
bioRxiv - Cell Biology 2021Quote: ... coupled to the FAM (fluorescein amidite) dye (Biosearch Technologies, Stellaris Custom Probes) were used ...
-
bioRxiv - Cancer Biology 2020Quote: Fluorescence (Quasar 670 Dye)-conjugated EGFR DesignReady probe was purchased from Biosearch Technologies. RNA FISH was performed on HF3016 cells transfected with Casilio-labeling components using manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... and custom synthesized conjugated with Quasar-670 dye (Biosearch Technologies, #SMF-1065-5). The pool of FISH probe set (5 nmol ...
-
bioRxiv - Neuroscience 2020Quote: ... Thirty-three (33) DNA probes conjugated to Quasar 670 dye (LGC Biosearch Technology) were designed to be antisense to all regions on apc/ebp mRNA without significant complementarity to other mRNAs in the Aplysia Refseq database (NCBI ...
-
bioRxiv - Cell Biology 2020Quote: ... Both probe sets were labeled with CAL Fluor Red 590 Dye (Biosearch Technologies, Inc.). Samples were hybridized with the gag/gag-pol probe set according to the manufacturer’s instructions available online ...
-
bioRxiv - Cancer Biology 2020Quote: ... we ordered the RNA FISH probes conjugated with a Quasar 570 dye (Biosearch Technologies) targeting to the intronic region of human (hg19 ...
-
bioRxiv - Cell Biology 2021Quote: ... a set of 46 probes coupled to the Quasar570 dye (Biosearch Technologies, Stellaris Custom Probes) were used ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Cell Biology 2021Quote: Stellaris plp and gapdh smFISH probes conjugated to Quasar 570 dye (LGC Biosearch Technologies; Middlesex, UK) were designed against the coding region for each gene using the Stellaris RNA FISH probe designer (Ryder et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... we used Stellaris FISH probes targeting Renilla luciferase and labelled with the Quasar 570 dye (Biosearch Technologies). Cells were plated on glass coverslips (High Precision ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Cell Biology 2024Quote: Stellaris Plp and GFP smFISH probes conjugated to Quasar 570 or 670 dyes (LGC Biosearch Technologies; Middlesex, UK) were designed against the coding region for each gene using the Stellaris RNA FISH probe designer [17 ...
-
bioRxiv - Cell Biology 2023Quote: ... smFISH was performed using SunTag-V4 probes (59) labeled with Quasar 670 dye (Stellaris RNA FISH probes, Biosearch Technologies), as described above ...
-
bioRxiv - Cell Biology 2023Quote: RNA FISH experiments were done using Stellaris oligonucleotide probes labeled with Quasar 570 Dye according to the manufacture’s protocol (LGC Biosearch Technologies). Sequences of the probes are listed in Supplementary Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... Embryos were incubated overnight in a 37 °C water bath in HB with a final concentration of 0.4 µM Stellaris smFISH probes (Cen or GAPDH) conjugated to Quasar 570 dye (LGC Biosearch Technologies). The following day ...
-
bioRxiv - Cancer Biology 2020Quote: ... A set of Stellaris RNA FISH Probes labeled with Cy5 dye specific to Hmrhl targeted transcript was purchased from Biosearch Technologies. Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Cell Biology 2023Quote: Xist RNA was detected with Stellaris® RNA FISH (Human XIST with Quasar® 570 Dye, Biosearch Technologies, SMF-2038-1) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... mRNA targets were detected in embryos using smiFISH probes designed to exonic sequence with 5’ end X flap sequences [78] and using secondary detection probes labelled with Quasar 570 or Quasar 670 fluorophore dyes (LGC Biosearch Technologies). Probe sequences are listed in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were incubated with the pre-hybridization buffer containing ACTB probes labelled with Quasar 670 dye (Stellaris RNA FISH probes, Biosearch Technologies) at a final concentration of 500 nM for 20 hours at 37°C to label β-actin mRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... custom oligo probes were ordered against the entire timeless mRNA sequence and conjugated with Quasar 670 dye (Stellaris Probes, Biosearch Technologies). The probes were diluted to a final concentration of 0.75 mM for the hybridization reaction ...
-
bioRxiv - Cell Biology 2024Quote: Single molecule RNA fluorescence in situ hybridization was performed with custom Stellaris RNA FISH probes labelled with Quasar 670 dye (LGC Biosearch Technologies) targeting the Xbp1 mRNA.
-
bioRxiv - Genetics 2021Quote: ... The mock-treated or infected nematodes were hybridized with the Stellaris RNA FISH Probe set labeled with CAL Fluor® Red 590 Dye (Biosearch Technologies, Inc.), following the manufacturer’s instructions available online at www.biosearchtech.com/stellarisprotocols based on protocols by Raj et al ...
-
bioRxiv - Cell Biology 2020Quote: Custom Stellaris RNA FISH probes labeled with Quasar dyes (i.e., Quasar®570 or Quasar®670) were designed against specific centromere RNAs and purchased from Biosearch Technologies (Petaluma, CA). To conduct single molecule FISH ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were re-fixed with 4% formaldehyde for 10 min and then hybridized with Stellaris RNA FISH probe for mouse Xist with Quasar 570 dye (BioSearch Tech, SMF-3011-1). First ...
-
bioRxiv - Genetics 2024Quote: Stellaris® FISH Probes recognizing either the coding region of eGFP mRNA or GAPDH mRNA labeled with Quasar® 670 Dye (VSMF-1015-5 for eGFP and SMF-2019-1 for GAPDH, from Biosearch Technologies, Inc., Petaluma, CA) were hybridized to HEK293T cell lines expressing integrated eGFP reporters with different length 3′UTRs according to manufacturer’s protocol ...