Labshake search
Citations for Biosearch Technologies :
1 - 23 of 23 citations for CKLF Like MARVEL Transmembrane Domain Containing 7 CMTM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The titers of NP-specific antibody isotypes in sera were measured by ELISA using plates coated with NP(7)- BSA or NP(20)-BSA (Biosearch Technologies) as described previously (63).
-
bioRxiv - Immunology 2019Quote: ... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
bioRxiv - Microbiology 2019Quote: ... with a 7-hour hybridization at 30°C of the custom Stellaris™ (Biosearch Technologies) probes labeled with Quasar® 670 dyes for the SANTV RNA1 molecule and with Cal Fluor Red® 610 Dyes for the LEBV RNA1 molecule (Table S1b).
-
bioRxiv - Bioengineering 2021Quote: ... were immunized for a total of 7 times over 28 days with recombinant ovalbumin (Biosearch Technologies) as a model antigen ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing Stellaris RNA FISH probes (Biosearch Technologies) at a final concentration of 125 nM (Supplementary File 6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing Stellaris RNA FISH probes (Biosearch Technologies) at a final concentration of 125 nM (Supplementary Table 7 ...
-
bioRxiv - Immunology 2021Quote: 7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... a set of oligonucleotides spanning the first intron of let-7-C was designed using the Stellaris Probe Designer software (Biosearch Technologies). The oligos were ordered from Biosearch Technologies labeled with Quasar-670.
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous Cdc42 isoforms were detected with 5’ Cy5-labelled Stellaris probes to the exons 6 or 7 (probe sequences available upon request; BioSearch Tech.). Hybridization conditions for Stellaris probes for cultured neurons and for tissue sections was performed as recently described (Terenzio et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... 300 μL of the permeabilized cells per hybridization sample were then pelleted (400 g, 7 minutes) and washed in 500 μL of wash buffer A (Biosearch Technologies, SMF-WA1-60 ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then incubated overnight at 37C in hybridization buffer containing smFISH probes (Biosearch Technologies) diluted 1:50 ...
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Coverslips were that moved to hybridization buffer containing 90% Stellaris hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 10% deionized formamide ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100μl of hybridization probe (100mg/ml dextran sulfate, 10% formamide, 2X SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) was added to the coverslips and incubated for 48 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Cell Biology 2019Quote: ... containing Dapi for 30 minutes at 37°C and then once with Stellaris wash buffer A (Biosearch technologies SMF-WA1-60) containing 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were incubated with the pre-hybridization buffer containing ACTB probes labelled with Quasar 670 dye (Stellaris RNA FISH probes, Biosearch Technologies) at a final concentration of 500 nM for 20 hours at 37°C to label β-actin mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nucleofected clones were isolated by limiting dilution and indel-containing clonal populations were screened by extracting gDNA using Quick Extract (Biosearch Technologies) for PCR amplification using primers targeting up and downstream the Cas9 cut-site ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.