Labshake search
Citations for Charles River Labs :
1 - 35 of 35 citations for Recombinant Human IL6R Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Microbiology 2020Quote: ... the recombinant viruses were amplified in 10-day old specific pathogen free eggs (Charles River). Viral titers were determined by plaque assay in MDCK cells using standard techniques.
-
bioRxiv - Microbiology 2020Quote: ... The gRNAs and recombinant Cas9 (RNPs) were electroporated into zygotes of C57BL/6N mice (Charles River Laboratories). DNA from the mice generated from the electroporations was sent to the Genome Engineering and iPSc Center at Washington University in St ...
-
bioRxiv - Immunology 2022Quote: ... Brca1-/-luciferase-tagged cells in PBS were injected via intraperitoneal route in 8–10-week-old female C57BL/6 mice (Charles River Laboratories International Inc.). Imaging was started at day-7 post-cell injection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human brain metastatic cells were injected in Foxn1 Nu/Nu (Charles River, Germany) or NOD-scid IL2rγnull (NSG ...
-
bioRxiv - Immunology 2021Quote: ... the cells were washed and cultured in 48-well plates for 2 weeks supplemented with recombinant interleukin-2 (IL-2, Charles River Labs, USA) at 20 IU / mL every 2–3 days thereafter ...
-
bioRxiv - Neuroscience 2023Quote: ... and CHO cells stable expression of human NaV1.8 (CHO1.8) were obtained from Charles River, Neuronal NG108-15 (NG105 ...
-
bioRxiv - Immunology 2021Quote: Human CD4 knock-in (hCD4KI, genOway, Lyon, France) and wildtype C57BL/6J mice (Charles River) were injected intravenously with 5 µg (∼15 MBq ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Experiments and procedures on non-human primates were performed as fee-for-service by Charles River Laboratories with approval of Charles River’s Institutional Animal Care and Use Committee (IACUC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Routine human and mouse pathogen screening was performed on original and passaged tissue by Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2022Quote: Non-human primate (NHP) studies were conducted at Charles River Laboratories (Shrewsbury, MA) and approved by Charles River-MA Institutional Animal Care and Use Committee (IACUC ...
-
bioRxiv - Cell Biology 2023Quote: CD4+ and CD8+ cells were positively selected from a de-identified healthy human donor apheresis (Charles River Laboratories) using anti-CD4 and anti-CD8 microbeads (Miltenyi ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Physiology 2022Quote: ... Mice expressing the cre recombinase under the control of the human cytomegalovirus minimal promoter (CMV-cre+/-) were purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Developmental Biology 2022Quote: ... was used to identify potential binding partners for multimerised human CACHD1 ectodomain (prepared as above) and was performed by Charles River Discovery Research Services UK Limited (formerly Retrogenix Limited ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The effects of PF-07304814 and PF-00835231 on human red blood cell hemolysis and plasma flocculation were evaluated in GLP-compliant studies conducted by Charles River Laboratories on behalf of Pfizer Inc ...
-
bioRxiv - Immunology 2023Quote: ... Nephrectomies were performed on 12 human C5aR knock-in male mice aged 7-10 weeks by a surgeon contracted from Charles River Laboratories ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney cells 293 stably expressing human hyperpolarization-gated cyclic nucleotide-sensitive cation channel 1 (HEK-HCN1) were obtained from Charles River (CT6114). Cells were cultured and maintained according to the online protocol by Charles River ...
-
bioRxiv - Genomics 2021Quote: ... Pregnant mare serum gonadotropin (5 units) and human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories) with a 48-h interval ...
-
bioRxiv - Cell Biology 2023Quote: Tumors were generated by intradermal injection of 5000 human metastatic melanoma cells (1205Lu) in anaesthetized Crl:NU(NCr)-Foxn1nu (athymic nude mice; Charles River, Rockville MD). Cells stably expressing GFP-cGas and mScarlet NLS were injected in a 1:1 mixture of Matrigel and minimal essential medium (Gibco ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Pathology 2022Quote: ... The pregnant mare serum gonadotropin (5 units) and the human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) with a 48h interval ...
-
bioRxiv - Developmental Biology 2021Quote: Pregnant mare serum gonadotropin (five units) and human chorionic gonadotropin (five units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) at a 48-h interval ...
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...