Labshake search
Citations for Charles River Labs :
1 - 14 of 14 citations for Glutathione S transferase Class mu 26 kDa Isozyme GST Schistosoma Japonicum since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Swiss Webster mice (Charles River, Wilmington, MA, USA. n=26) of both genders ages 3 to 7 months were utilized ...
-
bioRxiv - Neuroscience 2021Quote: Swiss Webster mice (Charles River, Wilmington, MA, USA. n=26) of both genders ages 3 to 7 months were utilized ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 week-old Sprague-Dawley rats (n=26; Charles River Laboratories, Wilmington, MA, USA) were utilized for all implantation procedures ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Adult male CF-1 WT albino mice 26-35 g were obtained from Charles River, Senneville ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Adult male CF-1 WT albino mice 26–35 g were obtained from Charles River, Senneville ...
-
bioRxiv - Neuroscience 2023Quote: We used 8–10-week-old C57BL/6N (20–26 g) mice from Charles River Laboratories in our experiments ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... 26]) male (m) and female (f) C57BL/6J mice were delivered by car from Charles River, Germany ...
-
bioRxiv - Cell Biology 2020Quote: ... Young (4-6 month-old) and aged (24-26 month-old) C57BL/6 mice (Charles River colony) and F344 rats (25-30 month-old ...
-
bioRxiv - Neuroscience 2022Quote: Female Long–Evans rats (n = 26 250–300 g at time of surgery; Charles River Laboratory, Raleigh, NC) that were naïve to tastants served as subjects in this study ...
-
bioRxiv - Neuroscience 2023Quote: ... Seven-week-old female (n = 108) and nine-week-old male (n = 26) Long-Evans rats were obtained from Charles River Laboratories and acclimated to the animal facility for two weeks ...
-
bioRxiv - Neuroscience 2020Quote: Experiments were performed with 10 weeks-old male and female C57BL/6J mice (26±4 g and 20±4 g, respectively; Charles River, L’Arbresle, France). Animals were housed according to a 12 h light-dark cycle ...
-
bioRxiv - Neuroscience 2023Quote: Experiments were performed with ten weeks-old male and female C57BL/6J mice (26±4 g and 20±4 g, respectively; JAX:006362; Charles River, L’Arbresle, France). Male and female mice were group-housed at 5 per cage ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Biochemistry 2023Quote: Cortical neuron cultures were established from neonatal mouse brains (wild-type C57BL/6, Charles River, strain code 027, or the genotype(s) indicated for each experiment ...