Labshake search
Citations for Promega :
1 - 47 of 47 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Buffer 1X (Gold ST*R 10X Buffer (Promega, Madison, WI)) ...
-
bioRxiv - Neuroscience 2020Quote: ... IgSF8-EGFP and Tenascin-R-EGFP plasmids using Fugene6 (Promega). Twenty-four hours after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... first with 1 µg r-LysC Mass Spec Grade (Promega) for 4 h at 30°C and then samples were diluted below 2 M urea with 100 mM Tris HCl pH 8.5 and 1 µg Sequencing Grade Modified Trypsin was added for the second digestion overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... first with 1 µg r-LysC Mass Spec Grade (Promega) for 4 h at 30°C and then samples were diluted to 1.8 M urea with 100 mM Tris HCl pH 8.5 and 1 µg Sequencing Grade Modified Trypsin was added for the second digestion overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... first with 500 ng r-LysC Mass Spec Grade (Promega) for 4 h at 30°C and then samples were diluted below 2 M urea with 100 mM Tris HCl pH 8.5 and 500 ng Sequencing Grade Modified Trypsin was added for the second digestion overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μL of 7.5 M guanidine hydrochloride was added to 10 μL of reaction mixture and incorporated radioactivity was captured on SAM2® Biotin Capture Membranes (Promega, Madison, WI) and quantified using liquid scintillation counting as described before.16
-
bioRxiv - Cancer Biology 2024Quote: ... Dyclonine hydrochloride for 7 days and cell viability was detected by Cell Titer-Glo Luminescent Cell Viability Assay Kit (Promega, catalog number: G7573).
-
bioRxiv - Neuroscience 2020Quote: ... IgSF8-EGFP or Tenascin-R-EGFP expression constructs using Fugene6 (Promega). Twenty-four hours after transfection ...
-
bioRxiv - Plant Biology 2021Quote: Total RNAs were obtained using Maxwell(R) RSC Plant RNA Kit (Promega). For RNA-Seq ...
-
bioRxiv - Genetics 2020Quote: ... DNA concentration was measured using the QuantiFluor(R)dsDNA System(a) (Promega, USA) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Firefly and Renilla luciferase activities were measured using a luminometer (Promega GloMax(R) Navigator with Dual Injectors) ...
-
bioRxiv - Developmental Biology 2024Quote: ... luciferase expression was assayed using the Dual-Luciferase (R) Reporter Assay System (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: ... and quantified on a Quantus™ Fluorometer using the QuantiFluor(R) dsDNA System (Promega). The quantification of copies of 16S rDNA was divided by the number of copies naturally present per cell (5 copies·cell-1 according to rrnDB database) ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTiter 96(R) AQueous MTS Reagent Powder were provided by Promega (Madison, Wisconsin, USA). NdCl3 (>99% ...
-
bioRxiv - Neuroscience 2023Quote: ... miR153 Upstream Seq HindIII R: TATATAAAGCTTCTAAGTAGCTGGCAAAGT) of promoter-less pGL4.10 Firefly luciferase construct (Promega), and the NFAT binding site mutated via site directed mutagenesis (miR153 NFAT Mut F ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence was measured after 72 h using the Renilla-Glo(R) Luciferase Assay System (Promega E2750) and the GlomAX® Discover Multimode Microplate Reader (Promega) ...
-
bioRxiv - Genomics 2021Quote: ... was extracted from tissue samples using a commercial kit (Wizard R Genomic DNA Purification Kit, Promega) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... primers designed for the gene of interest (Table 1) and GoTaq(R) qPCR Master Mix (Promega). Samples were run on an AB 7300 Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... and both FF-Luc and R-Luc activities were measured using the Dual-luciferase Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... TNF-α (human; DuoSet; R&D) and relative LDH levels using a CytoTox 96 Kit (Promega). For THP-1 viability assays ...
-
bioRxiv - Biochemistry 2021Quote: ... and stained with Coomassie blue R-250 before in-gel digestion using modified trypsin (Promega, sequencing grade) as previously described 74 ...
-
bioRxiv - Bioengineering 2021Quote: ... A standard curve was prepared through cloning method using pGEM(R)-T Easy Vector System II (Promega) and JM109 Competent Cells (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... and stained with Coomassie blue R-250 before in-gel digestion using modified trypsin (Promega, sequencing grade) as previously described [88] ...
-
bioRxiv - Microbiology 2022Quote: ... Relative F-Luc activity compared to R-Luc was quantified using a dual luciferase assay (Promega, E1960).
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with primers Dmd_e22-e24.F / Dmd_e22-e24.R using GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Biochemistry 2021Quote: ... R-Luc and F-Luc activities were measured 48 h after transfection using the Dual-Luciferase Reporter Assay System (Promega). Renilla luciferase activity was normalized to firefly luciferase.
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... were calculated as the ratio of the fluorescence intensities between the initial (F0) and the last (F) 100 seconds by R-CEPIA1er in the Glomax Discover Microplate Reader (Promega). Caffeine-induced Ca2+ transients were also measured with Fura2 AM at room temperature using an ECLIPSE Ti/L100 epifluorescence microscope (Nikon ...
-
bioRxiv - Cell Biology 2023Quote: ... Presence of rat cells in myoblast culture/muscle lysate was assessed by PCR for rat dystrophin using primers Rat Dmd i22-i23.F/ Rat Dmd i22-i23.R and GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Immunology 2024Quote: ... Supernatants were then assayed for IL-1β (human; DuoSet; R&D) and relative LDH levels (as a surrogate for pyroptosis) using a CytoTox 96 Kit (Promega). For the THP-1 LPS signaling assays ...
-
bioRxiv - Immunology 2024Quote: ... Supernatants were then transferred to a 96-well plate for storage and assayed for IL-1β (human; DuoSet; R&D) and relative LDH levels using a CytoTox 96 Kit (Promega). Once supernatants were removed ...
-
bioRxiv - Microbiology 2024Quote: ... gonorrhoeae dedA gene and a kanamycin resistance cassette (Primer: kanR (kanamycin resistance) cassette F/R) were amplified using GoTaq master mix (Promega). The fragments were then assembled using NEBuilder HiFi DNA assembly master mix (NEB ...
-
bioRxiv - Immunology 2024Quote: ... Supernatants are then transferred to a fresh 96-well plate for storage and assayed for IL-1β (canine, monkey, porcine, rabbit or rat; DuoSet; R&D) and relative LDH levels using a CytoTox 96 Kit (Promega). Once supernatants are removed ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Genomics 2022Quote: ... F-luciferase and R-luciferase expression was assayed in a TECAN Spark plate reader using the Dual-Glo® Luciferase Assay System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Lysates were used to measure the activity of F-Luc and R-Luc via the Dual-Luciferase Reporter Assay System (Promega, E1960) in a GloMax 20/20 luminometer (Promega ...
-
bioRxiv - Microbiology 2022Quote: 5’-LTR of HERV-R was cloned in fusion with the downstream Gaussia Luciferase (G-Luc) into the pGL3 basic vector (Promega, USA). The sequence corresponding to 596 nucleotides of HERV-R 5’-LTR (22061-22657 base pairs on human chromosome 7q11 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the hdhfr positive selectable marker cassette was PCR amplified from the vector pL-6_eGFP(64) with primers hdhfr 5’ F and hdhfr 3’ R and cloned into pGEM-3Z (Promega, Madison, WI) digested with HincII ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-R: 5′-TGC CTC GAG CTC AAG TGT CTG TGGATC AC-3′) into pGEM T-easy vector (Promega, Madison, WI, USA). A standard curve was generated by determining the copy numbers derived from serial dilutions of the plasmid (103–109 copies) ...
-
bioRxiv - Microbiology 2020Quote: ... OXA-111-NcoI F or OXA-71-NcoI F and OXA-66-XhoI R primers (Table 2) and TA cloned into the vector pGEM-T Easy (Promega, United Kingdom). The inserts were confirmed by sequencing with the universal T7 Promoter primer ...
-
bioRxiv - Microbiology 2024Quote: ... and the three randomly selected variants (AMA22_1 IHCA and AMA23 IHC AVI 4 μg/mL and R AVI 8 μg/mL) was performed following the manufacturer’s instructions using the Wizard Promega kit (Promega, Madison, WI, USA). For whole genome sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... Genomic DNA was extracted from leaf tissue using a modified protocol for Wizard(R) Magnetic 96 DNA Plant System from Promega (Madison, Wisconsin, USA). The copy number of integrated T-DNA in transgenic soybean plants was measured in duplex TaqMan assays ...
-
bioRxiv - Biochemistry 2021Quote: ... After the capture step, beads were washed with PBS-casein and recovered using a Magnetic Rack (Ref Z5343, MagneSphere(R) (Promega, Madison, Wisconsin, USA), for tubes ...
-
bioRxiv - Molecular Biology 2024Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... cells reached 50-60% confluence and were transfected with 350 ng of ADGRL3 + 350 ng 22F Glosensor reporter plasmid (E2301; Promega – a gift from R. Lefkowitz lab) + 9 ng of β2-adrenergic receptor + 2.8 uL of transfection reagent Fugene 6 ...