Labshake search
Citations for Promega :
301 - 350 of 4684 citations for 2' Chloro 4 5 5 dimethyl 1 3 dioxan 2 yl butyrophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 2 U RNase-free DNase (Promega), 1 mM CaCl2 ...
-
bioRxiv - Genetics 2024Quote: The psi-CHEK-2 plasmid (Promega) was used for the luciferase assay ...
-
bioRxiv - Cell Biology 2020Quote: ... One 10-cm plate of HEK-293T cells at 90% confluency was transfected with 6.5 μg of the pBMN-ARHGAP36 (isoform 2)-mCherry mutant library and 4 μg of pCL-ECO using the FuGene HD transfection reagent (Promega). The medium was replaced after 24 hours with DMEM containing 1.8 mM L-glutamine ...
-
bioRxiv - Biophysics 2020Quote: ... Plasmids were transfected in cells (passage number < 35) seeded in 96-well plates at ~50 % confluence 2-4 days before the experiment with FuGene6 (Promega) or Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmids were transfected in cells (passage number < 35) seeded in 96-well plates at ~50 % confluence 2-4 days before the experiment with FuGene6 (Promega) or Lipofectamine 2000/3000 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein was then digested with 2.5 μg Lys-C (Wako, Japan) for 4 h at 37°C and 2 μg trypsin (Promega, V5113) for an additional 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was diluted either 1:5 or 1:10 for all qPCR experiments and GoTaq qPCR Master Mix (Promega) was used to amplify cDNA ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay Virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system (RNA1 qPCR primers GW194 and GW195)23.
-
bioRxiv - Microbiology 2021Quote: ... diluted 1:2 with PBS and read on a GloMax Multi+ Detection System (Promega). CSV files were exported onto a USB flash drive for analysis.
-
bioRxiv - Systems Biology 2020Quote: ... The transfections were performed with 1 μg DNA: 2 μl Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Microbiology 2022Quote: ... diluted 1:2 with PBS and read on a GloMax Multi+ Detection System (Promega).
-
bioRxiv - Immunology 2022Quote: ... 1-2 µg RNA was reverse transcribed using AMV Reverse Transcriptase (Promega, Madison, WI). Primers were purchased from Integrated DNA Technologies (IDT ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1-2 µg of RNA was reverse transcribed into cDNA using GoScript (Promega).
-
bioRxiv - Cell Biology 2024Quote: ... and 1-2 µg of RNA was reverse transcribed into cDNA using GoScript (Promega).
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The amplicons generated from the 5’ and 3’ race PCRs were subjected to purification and subsequent cloning into the pGEM-T easy vector (Promega Corp., WI, USA). The constructed vectors were sequenced (Plasmidsaurus ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng renilla control reporter vector (Promega), mock luciferase ...
-
bioRxiv - Genomics 2024Quote: ... lysed by a 5× reporter lysis buffer (Promega) and incubated overnight at −20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 2 mM DTT, 100 μg ml-1 cycloheximide [Sigma], 20 U ml-1 RNase inhibitor [Promega] ...
-
bioRxiv - Neuroscience 2023Quote: ... At DIV12 cells are lysed in Passive lysis buffer (diluted 1:5 in MilliQ-water, Promega) for 15min and dual luciferase assay performed using home-made reagents according to Baker and Boyce (63 ...
-
bioRxiv - Biophysics 2024Quote: ... we applied 100 μl of 1:5 diluted cell culture lysis reagent (Promega, Cat. No.: E1531) to each well ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... 16.5 μg attB-plasmid library + 3 μg pCAG-NLS-Bxb1 + 2 μg pMAX-GFP + 2150 μL serum-free DMEM + 80 μL FugeneHD (Promega cat# E2311), then incubated at room temperature for 15 min and added dropwise to cells ...
-
bioRxiv - Developmental Biology 2024Quote: ... tRFValCAC sequence was inserted into the multiple-cloning site at the 3’ end of the hRluc gene within the psiCHECK-2 Vector (Promega, cat # C8021). mESCs were transfected using the method described above ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Cell Biology 2022Quote: ... β-arrestin 2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin 2; Promega, plasmid no. CS1603B118) was chosen as it has previously been used successfully with other class B GPCRs ...
-
bioRxiv - Immunology 2023Quote: ... samples were diluted 1:1 with water and digested for 1.5 hours at 37 °C with 1 µg of LysC and overnight at 37 °C with 1 µg trypsin (Promega). The peptide mixture was acidified with trifluoroacetic acid (Merck ...