Labshake search
Citations for Promega :
151 - 200 of 5247 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: SARS-CoV-2 variant spike pseudotyped lentiviral particles were produced in 293T cells (ATCC) using Fugene transfection reagent 6 (Promega; E2691). Two million cells were seeded in D10 (DMEM(Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Transfection solutions were made at a lipid (µg) to plasmid (µL) ratio of 3:1 using FuGene 6 (Promega) as the transfection reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... and their numbers were measured every 2–4 days using the CellTitre-Glo 3D cell viability assay (Promega), as described by the manufacturer ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: The psiCHECK-2 plasmid (Promega) has a special NheI restriction site that was used to insert a synthetic DNA duplex encoding the G-rich region of the PRCC-TFE3 fusion gene in the upstream of the renilla luciferase initiation codon to create the plasmids G4Q27 and G4M27 (mutated G-rich region of the PRCC-TFE3 fusion gene) ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1,3 μg of plasmid DNA and 3 μl of FuGene 6 (Promega) were mixed in 100 µl Opti-MEMTM medium before the addition to the dish ...
-
bioRxiv - Molecular Biology 2024Quote: ... HeLa-HA cells were transfected with 3 μL of FuGENE 6 (Promega) and 1 μg pA2 plasmid DNA per well of a six well plate ...
-
bioRxiv - Molecular Biology 2024Quote: ... HeLa-HA cells were transfected using 3 μL of FuGENE 6 (Promega) and 0.5 μg Alu reporter plasmid + 0.5 μg TMO2F3 plasmid DNA per well of a six well plate as noted above ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... The WT and mutated 5’UTR sequences were ligated into a linearized reporter plasmid (psiCHECK-2 vector, Promega). The entire sequences of all the plasmids were validated by Sanger sequencing ...
-
bioRxiv - Immunology 2024Quote: ... followed by 2 mL of barcode buffer (dPBS with 0.5% BSA and 5 μg/mL Herring DNA (Promega)) and then stored at 4°C prior to loading with the probe pool ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The WT and mutated 5’UTR sequences were ligated into a linearized reporter plasmid (psiCHECK-2 vector, Promega). The whole sequence of all the plasmids was validated by Sanger sequencing.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were suspended in 10 mL MACS buffer (2% FBS, 2 mM EDTA (Promega, V4231) diluted in phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were developed with a commercial solution of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) according to the manufacturer (Promega, Madison, WI), in alkaline developing solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... (49) as a negative control (2 μg of DNA per well of 6 well plate) with FuGene transfection reagent (Promega, Madison, WI) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated for an additional 2 – 6 days and cell growth was quantified using CellTiter-Glo® 2.0 Reagent (Promega, Cat. #924C). For immunoblot analysis ...
-
bioRxiv - Physiology 2023Quote: ... UMR106 cells were plated at 4 × 105 per well in a 6-well plate and transfected with 2 µg of NFAT5 gRNAs per well using the FuGENE® HD Transfection Reagent (Promega, USA). 24 h post-transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... Aliquots #1 and #2 were then treated with 1 mg/mL trypsin (Promega, Madison, WI, USA) and incubated at 37 °C for 1 h followed by the addition of 1.5 mg/mL trypsin inhibitor (Worthington Biochemical Corp ...
-
bioRxiv - Biochemistry 2023Quote: BromoTag cell lines were generated in HEK293 cells via simultaneous transfection of two vectors at a 4:1 reagent:DNA ratio with FuGENE 6 (Promega). The first vector was a pMK-RQ vector containing 500 bp homology arms on either side of either an eGFP-IRES-BromoTag or eGFP-IRES-HiBiT-BromoTag sequence for integration into MCM4 and BRD4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the pSARP-12R4-9 input library with a 3:1 transfection reagent:DNA ratio using Fugene 6 transfection reagent (Promega #E269A). At 72 hrs ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 10,000 x g and 4°C for 2 min and digested by addition of RNAse-free DNAse I (Promega) for 10 min on ice ...
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transiently transfected with 1 or 2 µg HaloTag-Ubiquitin (N2721, Promega) or the control vector pHTN HaloTag CMV-neo (G7721 ...
-
bioRxiv - Molecular Biology 2021Quote: ... were inserted using XhoI and NotI sites in 3’ UTR of Renilla gene in the psiCheck-2 dual luciferase reporter vector (Promega). The reporter in the amount of 25 ng and plasmids with different NORAD variants in the amount of 200 ng were introduced per 30,000 cells in 24-well plates ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Molecular Biology 2024Quote: Luciferase PRE reporters were generated by inserting PRE repeats into the 3’UTR of Renilla luciferase in the psiCheck-2 dual luciferase reporter vector (Promega) (Table S7) ...
-
Aberrant regulation of serine metabolism drives extracellular vesicle release and cancer progressionbioRxiv - Cancer Biology 2024Quote: ... The annealed oligos were ligated into the Xho I and Not I sites in the 3’UTR of the Renilla luciferase gene in the psiCHECK-2 plasmid (C8021, Promega). Each plasmid was transfected individually into HEK 293 cells with miR-891b using DharmaFECT 1 Transfection Reagent (T-2001-03 ...
-
bioRxiv - Physiology 2021Quote: ... and 5 μg lentiviral construct with 30 μL Fugene 6 (Promega) the following day ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Molecular Biology 2021Quote: ... before cells were permeabilized using 0.2% Triton X-100 PBS for 10 min at room temperature, then blocked for 30 min (2% BSA / 0.5% fish skin gelatine / PBST.5, 2U/µL RNAsin Plus (Promega) at room temperature) ...