Labshake search
Citations for Promega :
101 - 150 of 697 citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length fragment of human PFKFB3-5 was amplified with primers PFKFB3-5 reverse and PFKFB3-5 forward and subcloned into the plasmid pGEM-T using the T/A Cloning Kit (Promega, Mannheim, Germany). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... A fragment of the rat Piezo 1 cDNA was amplified with Taq Polymerase and the oligonucleotide primers 5’-GAGGAAGAGGACTACCTT and 5’-TTTACTTAGAAAACCCTACAG from bladder total RNA and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Sequence was confirmed by Sanger capillary sequencing and sense and antisense RNA probes were synthesized with T7 and SP6 RNA polymerases (Roche-Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... The effect on cell viability of PTNP was assessed using the MTS [(3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium)] assay (CellTiter 96 cell proliferation assay kit; Promega, WI, USA) (92) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µL of 5X GoTaq Green Master Mix (Promega), 0.125 µL of 5u/µL GoTaq G2 polymerase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and serial dilutions of indicated human mAbs ...
-
bioRxiv - Systems Biology 2020Quote: 100 mM TEAB and 5 ug trypsin (Promega V5113)
-
bioRxiv - Neuroscience 2021Quote: ... + 5% RNAse inhibitor (40U/ul, Promega RNAsin inhibitor N2511). Samples were then transferred to a tube for processing by our Genome Technology Access Center (GTAC ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Cancer Biology 2021Quote: ... then digested with 5 ng / μl Trypsin Gold (Promega) in 9% Acetonitrile and 40 mM Ambic ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng of Renilla luciferase plasmid (Promega pRL-CMV), and 50 ng of Gal4-DNA binding domain-human RORγt-ligand-binding domain fusion protein plasmid per each well ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 µl of 5X Green GoTaq Buffer (Promega, M791A), 0.2 µl of GoTaq DNA polymerase (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and 10 μl of pooled mouse sera from naïve or immunized mice with HCoV-OC43 N-His ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼ 5 × 105 U2OS cells were transfected using FuGene6 (Promega) with 1μg of gRNA/Cas9 (px330 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Constructs were labeled with 5 μM Halo-TMR (Promega) in the column for 10 minutes at room temperature and unbound dyes were washed with TEV buffer at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% glycerol) with protease inhibitor mixture without EDTA (Promega), followed by the addition of 0.3% CHAPS ...
-
bioRxiv - Genetics 2024Quote: ... 5 µL of GoTaq G2 Green Master Mix (Promega), and 200 µM of primers ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 10 µL coelenterazine h (Promega, 5 µM final concentration) was added ...
-
bioRxiv - Cell Biology 2024Quote: ... at 5 µM in Tracer Dilution Buffer (Promega N291B) was added to all wells ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 5 μl of reconstituted 1xGTPase-Glo reagent (Promega) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 and exon 4 were cloned to pGL4.23 (Promega) upstream to the minimal promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μM Bright-Glo (Fluc Luciferase Assay System, Promega) was then added to the wells ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 U of recombinant RNasin (Promega) and 10 U of RQ1 RNase-free DNase (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Genomics 2023Quote: ... 5 ug sheared salmon sperm DNA (Promega, Madison, WI), 500 ng of RNA bait ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μL of 5X M-MLV reaction buffer (Promega), 5 μL of a mixture of 10 mM dNTPs and 200 U of M-MLV reverse-transcriptase (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... each 5 nL of injection volume contained: 70 pg of Anillin-Halo and 5 µM Janelia Fluor® 646 HaloTag® Ligand (Promega, #GA1120), or 70 pg of Anillin-3xGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μL of GoTaq® Probe qPCR Master Mix (Promega) and 0.5 μL of the appropriate TaqMan Assay (20X ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 μl of RNasin Plus RNase Inhibitor (Promega, N2611) and incubated for 2 hours at 4 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 U/μl GoTaq Flexi DNA Polymerase (Promega, WI, USA), and 1 μl of DNA template ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5 μL 2x buffer for T4 DNA Ligase (Promega) were mixed and incubated at 55°C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl of 5 ng/μl sequencing grade trypsin (Promega), 50mM AHC ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with 0.3 µg/ul Acetylated BSA (Promega). All RNAs used were labelled with 5’ FAM (IDT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 μL/well of CellTiter-Glo 2.0 reagent (Promega G9241) was added to the wells of the 384-well plate and allowed to equilibrate for 10 minutes before luminescence intensity was recorded on a Tecan SPARK plate reader (luminescence module ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM DTT and 5 μg/μl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Genetics 2022Quote: ... 5-mins after the addition of furimazine NanoLuc substrate (Promega). A range of expression ratios of the NanoLuc and HaloTag containing constructs within the cells was achieved by varying the proportion of each plasmid during transfection ...
-
bioRxiv - Plant Biology 2022Quote: ... and 5 μL of RNasin Plus RNase Inhibitor (Promega, N2611) and incubated for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μl of M-MLV Reverse Transcriptase Buffer (Promega #M531A), 10 mM NTPs mixture and 200 U of MMLV (Promega #M170A ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl/well NanoBRET™ Nano-Glo® Substrate (Promega) and Extracellular NanoLuc® Inhibitor (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 µL of 5× Green GoTaq® Reaction Buffer (Promega), 1 µL of dNTP Mix (10 mM each of dTTP ...