Labshake search
Citations for Promega :
101 - 150 of 2385 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... the final selection was performed by 3% agarose electrophoresis (80 V, 2 h, 1 kB Promega ladder). The selected clones were preincubated in growth medium (15 ml ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Biophysics 2024Quote: ... that was blocked for 2 hours in 5% milk TBST before being probed with (Promega) (CS2006A01 clone 30E5 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of NanoLuc was amplified by PCR using the primers 5-NanoL and 3-NanoL from pNL1.1.CMV plasmid (Promega). The resulting fragment was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 digested with the same enzymes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and Bone Morphogenetic Protein 4 (BMP4, 10 ng/ml, Bio-Techne) plus phosphoinositide 3-kinase inhibitor Ly294002 (10 µM, Promega). After 42 h incubation at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were passaged every 3–4 days and regularly checked for mycoplasma infections using a GoTaq G2 Hot Start Taq Polymerase kit from Promega.
-
bioRxiv - Bioengineering 2024Quote: ... control and printed aggregates were collected for 4 hours and 3 days post-printing and tested following the CellTiter96 (Promega) assay protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... protein samples were then incubated with chymotrypsin at a ratio of 1:80 (enzyme to protein) for 3-4 h at RT and then trypsin (Promega) at a ratio of 1:80 (enzyme to protein ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Biophysics 2024Quote: ... UCSD) was transiently transfected into RPE1 cells to labeling peroxisomes for 2 or 3 days using Viafect (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Fugene HD (Fugene HD [μL]:DNA [μg]:DMEM [μL] = 5:2:200;Promega, Madison, WI, USA) was used for transient transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Genomics 2022Quote: Cell viability upon siRNA transfection was measured through the CellTiter 96® Non-Radioactive Cell Proliferation Assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)) (Promega). 1× 104 microglia cells were plated per well in a 96 well plate and transfected with either ON-TARGETplus Non-targeting Control siRNA (Horizon Discovery) ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.5 µg (HEK293A, HEK293T, HEK293AΔARRB1/B2) or 2 µg (HEK293AΔGs, HEKS293AΔGi) Glo-22F cAMP plasmid DNA (Promega) and 2 µg MOCK DNA (HEK293A ...
-
bioRxiv - Cancer Biology 2023Quote: ... and their numbers were measured every 2–4 days using the CellTitre-Glo 3D cell viability assay (Promega), as described by the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Zoology 2024Quote: ... The amplicon target was amplified from WNV cDNA using the qPCR primers with the forward primer flanked by T7 sequence (5’-TAATACGACTCACTATAGGGATTCGGGAGGAGACGTGGTA-3’) and transcribed using T7 RiboMAX Express Large Scale RNA Production System kit (Promega, France). RNA was purified by ethanol precipitation ...
-
bioRxiv - Biophysics 2024Quote: ... labeling of TRPV1exCellHalo was completed in the imaging chamber by incubating cells with 3 μM Alexa660 Halo Ligand for 5 minutes (Promega, WI) in HBR followed by 3 minutes of continuous rinsing with HBR perfusion.
-
bioRxiv - Molecular Biology 2024Quote: ... the hdhfr positive selectable marker cassette was PCR amplified from the vector pL-6_eGFP(64) with primers hdhfr 5’ F and hdhfr 3’ R and cloned into pGEM-3Z (Promega, Madison, WI) digested with HincII ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA and 5% input were analyzed by qPCR using locus specific primers (Table 3) and SYBR Green Master Mix (Promega, A6002). IP DNA values were normalized to input using the following formula ...
-
bioRxiv - Cancer Biology 2024Quote: ... tissues were incubated with primary antibodies diluted in 10% DS in PB1 for 3 days at 4°C followed by four washes over the following day with 0.2% Tween-20 (Promega UK Ltd, H5151) in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... were inserted using XhoI and NotI sites in 3’ UTR of Renilla gene in the psiCheck-2 dual luciferase reporter vector (Promega). The reporter in the amount of 25 ng and plasmids with different NORAD variants in the amount of 200 ng were introduced per 30,000 cells in 24-well plates ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Molecular Biology 2024Quote: Luciferase PRE reporters were generated by inserting PRE repeats into the 3’UTR of Renilla luciferase in the psiCheck-2 dual luciferase reporter vector (Promega) (Table S7) ...