Labshake search
Citations for Promega :
701 - 750 of 4883 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... the cells were lysed with a 1:1 ratio of virus to Bright-Glo luciferase assay media (Promega, #E2610) and the contents were analyzed on a luminometer (LUMISTAR Omega ...
-
bioRxiv - Microbiology 2022Quote: ... cells were lysed by adding 100 µl of 1:1 (v:v) mixture of phenol red-free DMEM and Bright-Glo substrate (Promega) and luminescence detected using a Glomax Navigator (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM DTT) in presence of 1 mM Adenylyl-imidodiphosphate (AMP-PNP) and RNase inhibitor RNAsin (0.5 U, Promega) for 25 min at 4°C with head-over-end rotation ...
-
bioRxiv - Immunology 2022Quote: ... caspase-1 activity was quantified in supernatants using a commercially available assay (Caspase-GLO 1 Assay; Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated with the primary antibodies (1D4 1:1500, Anti-Calnexin Sigma c4731 1:600, Anti-LgBiT Promega N7100 1:100 ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay Virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system (RNA1 qPCR primers GW194 and GW195)23.
-
bioRxiv - Immunology 2023Quote: ... Media were removed and 100 μl of CTG reagent (CellTiter-Glo®, Promega GmbH, Germany; 1:1 with PBS) per well was added ...
-
bioRxiv - Microbiology 2023Quote: ... CM was then harvested by centrifugation and active caspase-1 measured with the Caspase-Glo 1 Inflammasome Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Sample C was treated with 1% Triton X-100 (TX100) followed by treatment with 1μg mL-1 trypsin (Promega). For the detergent treatment ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was initiated by the addition of 1-250 nM acylated peptide (Vivitide) and a 1:10,000 dilution of LgBiT subunit of the NanoBiT luciferase (Promega) and read using an Envision plate reader (XCite 2105 ...
-
bioRxiv - Genomics 2022Quote: ... Nuclei were resuspended in 200 μL resuspension buffer (1x PBS, 1% BSA and 0.2U μl/1 RNasin Plus RNase Inhibitor (Promega)) and transferred to a 1.5 mL Eppendorf tube tube ...
-
bioRxiv - Neuroscience 2023Quote: ... and Dounce homogenized in 500 µL of ice-cold RNase-free buffer polysome buffer (50 mM Tris pH 7.5, 100 mM KCl, 12 mM MgCl2, 1% NP-40, 1 mM DTT, 200U/ml Promega RNasin ...
-
bioRxiv - Developmental Biology 2023Quote: ... a minimum of 1 µg of RNA was combined with 1 µl of Oligo (dT)15 primer (Promega, C110B) and nuclease-free water to make up a total of 5 µl and incubated at 70°C and 4°C for 5 min each ...
-
bioRxiv - Developmental Biology 2023Quote: ... A minimum of 1 µg of RNA was combined with 1 µl of Oligo (dT)15 primer (Promega, C110B) and nuclease-free water to make up a total of 5 µl and incubated at 70°C and 4°C for 5 min each ...
-
bioRxiv - Molecular Biology 2023Quote: ... Two μL of reverse transcription buffer 5X were added and the samples were incubated at 20°C for 15 min before addition of 1.5 μL of dNTP mix (1 mM of dATP, dGTP, dCTP, dUTP) and 1 μL of AMV enzyme (PROMEGA). Reverse transcription was performed at 42°C for 45 min and synthesized cDNA was recovered by ethanol precipitation as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... The secondary antibody was a horseradish peroxidase polyclonal goat anti-mouse (from 1:5,000 to 1:10,000, depending on the primary antibody; Promega, W4021). Proteins were detected with the ECL chemiluminescence reagent (GE Healthcare ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL of HiBit buffer (LgBit 1:200, Promega, N112A; Furimazine 1:100 Promega, N113A in nuclease-free water) were added ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1 nM of linear template DNA) and supplemented with 1 µL of BODIPY-Lys-tRNALys (FluoroTect GreenLys, Promega) to incorporate fluorescently labelled lysine residues in the synthesized proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... 125 ng of which was the reporter plasmid mixture (1:1 ratio of 8xGli-nanoluc/pGl3b to pGL4.53[luc2/PGK] (Promega)) ...
-
bioRxiv - Physiology 2024Quote: ... Protein digestion was performed with Lysyl Endopeptidase (enzyme:substrate 1:100, 125-05061, Wako Pure Chemical Industries) and trypsin (enzyme:substrate 1:50, Promega V5113) overnight at 37°C with agitation (1,000 rpm) ...
-
bioRxiv - Immunology 2024Quote: ... Samples were digested overnight with LysC (Wako, 1:100 enzyme: protein ratio) and trypsin (Promega, 1:50 enzyme:protein ratio). Samples were desalted with a 96-well mini 20MG PROTO 300 C18 plate (HNS S18V ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were then diluted to 1 M urea and subjected to digestion with trypsin (Promega, 1:50 w/w) overnight at 37⁰C ...
-
bioRxiv - Biophysics 2024Quote: ... we stained the cells with 1 ml of a 1:2,000 TMR Halo-ligand solution (Promega, Cat. No.: G8251) to fluorescently label the Halo-tagged proteins ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was washed with Tris-buffered saline with 0.1% Tween-20 (TBST) and incubated with a secondary antibody (Gpx4 1:10000 or 4HNE 1:10000, W4011, Promega and Gapdh 1:10000 or ActB 1:5000 ...
-
bioRxiv - Cell Biology 2024Quote: ... diluted with 50 mM ammonium bicarbonate to 1 M urea and digested with trypsin (1:50 w/w, Promega) overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transfection was done using a ratio 3:1 volume-to-mass ratio of FuGENE6 (0.3 µL reagent: 100 ng of DNA per well, Promega E2691). The transfection mix included the following vectors ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were seeded onto acid-washed coverslips to ensure surface cleanliness and cell adherence at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1 μg of plasmid DNA using 3 μL Fugene HD transfection reagent (Promega). HaloTagged AP2-σ2 was visualized by adding the JF646-HaloTag ligand (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... treated with 3 units/sample of DNase I for 2 hours (Promega, Madison, WI, USA), and 1-3μl aliquots were taken for reverse transcription (RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 2) chymotrypsin and lysyl endopeptidase (lys-C) (Fujifilm Wako) 3) lys-C and trypsin (Promega) and 4 ...
-
bioRxiv - Neuroscience 2024Quote: ... The brain surface was covered in 2-3% low melting point agarose (Promega, Madison, WI) in sterile saline and then capped with silicone elastomer ...