Labshake search
Citations for Promega :
501 - 550 of 2107 citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with PBS and lysed with 100 µL of 0.05% Triton X-100 (Promega). The contents of the well were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with PBS and lysed with 100 µL of 0.05% Triton X-100 (Promega). The contents of the well were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... Concentrated protein extracts were then digested with 3 µl trypsin according to manufacturer’s instruction (Promega, Madison, WI, USA) at 37 °C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...
-
bioRxiv - Plant Biology 2024Quote: ... At least 3 independent technical experiments were performed from each RNA sample using SYBR Green Master Mix (Promega) with Chromo4 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptotic cell count was measured as described above using the Caspase-Glo® 3/7 3D Assay (Promega). Bliss synergy scores were calculated using the SynergyFinder web application (version 3.0)61.
-
bioRxiv - Cancer Biology 2024Quote: ... Further confirmation of apoptosis was performed using the Caspase-Glo 3/7 Assay (Promega UK, Cat No:8091) system ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Molecular Biology 2020Quote: Gently re-suspend cells in 100 μl of 3% Glyoxal fixation solution with 1:25 RNasin Plus (Promega N261B) and incubate for 15 minutes on ice.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was quantified to 3 μg to react 1 μg/μL random hexamer (C1181; Promega, Madison, WI, USA) at 70°C for 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Immunology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately O/N using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Pathology 2021Quote: ... Cytopathic effects of the virus were measured after 3 days using the CellTiter-Glo luminescent cell viability assay (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... The sample was first treated by 2.5 μg of LysC (Wako) for 3 h at 37 °C with shaking and then treated with 2.5 μg of Trypsin (Promega) for over-night at 37 °C with shaking ...
-
bioRxiv - Bioengineering 2021Quote: ... on a 3.5 cm glass-based dish were transfected with 1.0 μg of EBFP (plasmid DNA) using 3 μL of FuGENE HD Transfection Reagent (Promega) in 10 μL of Opti-MEM (Life Technologies Corporation) ...
-
bioRxiv - Microbiology 2021Quote: ... and NS1 (3′) sequences were determined from purified product cloned into the pGEM-T vector by TA-cloning (Promega) according to the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately overnight using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Cell Biology 2021Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were diluted 10-fold with 25 mM ammonium bicarbonate and digested with 3 µg of trypsin (Promega, v5111) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat. #E1531) prior to firefly and Renilla luciferase activity measurements which were performed in triplicate using the Dual-GLO kit (Promega cat ...
-
bioRxiv - Microbiology 2023Quote: ... Imaging was performed 3 min after intraperitoneal (i.p.) injection of 150 mg/kg D-Luciferin (Beetle Luciferin Potassium Salt, Promega) in the IVIS® Spectrum In Vivo Imaging System under 2.5% isoflurane inhalation anesthesia using 15 min exposure ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then transfected with plasmid DNA (4µg per plasmid per flask) using FuGENE HD (1:3 ratio; Promega) and cultured at 28°C.
-
bioRxiv - Molecular Biology 2024Quote: ... RT-PCR was used to amplify the OGDH 3’UTR and sub clone it into pmirGLO vector (Promega, UK). 5 × 10^4 C2C12 cells were seeded into 12 well plates ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CP4 medium was exchanged with Hanks’Balanced Salt Solution (with added glucose 1 g/l, NaHCO3 0.35 g/l) containing GloSensor cAMP Reagent (3 %, Promega) and plates were incubated for 60 min ...
-
bioRxiv - Genomics 2023Quote: ... at 0.5 uM or DMSO (vehicle) followed by measurement of Caspase activity via the Caspase-Glo 3/7 assay (Promega). Results are representative of at least 3 independent experiments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CytoTox-OneTM homogeneous membrane integrity assay kit and Caspase-Glo® 3/7 assay system kit were from Promega, WI ...
-
bioRxiv - Biophysics 2022Quote: ... DTT was added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37 °C overnight ...