Labshake search
Citations for Promega :
501 - 550 of 2385 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl biotinylated Transcend tRNA (Promega) was included in the reaction mix resulting in biotinylation of lysine residues ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 U RNase-free DNase (Promega), 1 mM CaCl2 ...
-
bioRxiv - Genetics 2024Quote: The psi-CHEK-2 plasmid (Promega) was used for the luciferase assay ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μL of CellTiter-Glo® (Promega cat#: G7570) were added to each well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM isopropyl β-d-1-thiogalactopyranoside (IPTG; Promega) was added to each RNAi well for induction of dsRNA synthesis and plates were incubated for 3-4 hours at 30°C and 155 rpm ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Samples were washed and endogenous biotin was blocked using Avidin/Biotin blocking kit (Vector laboratories ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... We identified a common tracer probe (K-4, Promega), suitable for all mutants ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 4 µL FuGene HD (Promega), 1 µg sgRNA-Cas9 plasmid DNA ...
-
bioRxiv - Biophysics 2022Quote: ... 4% glycerol with 12 units RNasin (Promega, Madison, WI), 10 μg/ml BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was determined using Caspase 3/7-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... freshly add 3 µL 1:1 water diluted digitonin (Promega G9441)) was added ...
-
bioRxiv - Immunology 2021Quote: ... then each well was diluted 1:3 with TE buffer (Promega). A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Biochemistry 2024Quote: ... using random primers and oligo-dT primers (3:1 mol) (Promega). The obtained cDNA was stored at −20 °C until further use.
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µl/well of room temperature Caspase Glo 3/7 (Promega) reagent was added to the treated and control cells ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 µg plasmid was combined with 3 µl FuGENE (Promega, E2311) in OptiMEM medium for each ml of culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: Caspase activity was measured using Caspase-Glo® 3/7 (Promega) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: Apoptosis was measured using the Caspase-Glo 3/7 Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...