Labshake search
Citations for Eton Bioscience :
1 - 2 of 2 citations for Zinc Finger With KRAB And SCAN Domains 5 ZKSCAN5 Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).