Labshake search
Citations for Eton Bioscience :
1 - 3 of 3 citations for I 309 CCL1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... or L-Lactate Assay Kit I (Eton Bioscience, 120001), respectively ...
-
bioRxiv - Genetics 2022Quote: ... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
bioRxiv - Cancer Biology 2023Quote: Lactate in spent growth media was determined employing the L-lactate Assay Kit I from Eton Biosciences (#120001400A, San Diego, CA). Sample lactate analysis was performed in the 96-will plate format with comparison to a standard curve in the range of 30 – 3000uM ...