Labshake search
Citations for Eton Bioscience :
1 - 12 of 12 citations for Human Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Serum lactate dehydrogenase level was measured at 3 days after MI by commercially available kit following manufacturer’s instructions (Eton Bioscience, San Diego, CA, USA). Fractional shortening was determined under basal conditions and after isoproterenol stimulation (10μg/kg ...
-
Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosomebioRxiv - Cell Biology 2020Quote: ... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
bioRxiv - Genetics 2022Quote: ... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
bioRxiv - Developmental Biology 2022Quote: ... and the L-lactate Assay Kit (Eton Biosciences, USA), respectively ...
-
bioRxiv - Physiology 2023Quote: ... or L-Lactate Assay Kit I (Eton Bioscience, 120001), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... Lactate production was analyzed using lactate assay kit (Eton Bioscience), followed the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... Glucose consumption was analyzed using glucose assay kit (Eton Bioscience), according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Glucose concentrations were conducted using a Glucose Assay Kit from Eton Biosciences according to manufacturer’s specifications and readings were carried out using a SpectraMax i3 spectrophotometer (Molecular Devices ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lactate levels were determined using a lactate assay kit (Eton Bioscience, San Diego, CA). Absorbance was recorded at 570 nm at room temperature in a 96-well plate ...
-
bioRxiv - Genetics 2019Quote: Extracellular glucose from cell culture medium was measured using glucose assay kits per manufacturer’s instructions (Eton Biosciences, USA). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmid DNA was harvested using the QIAprep Spin Miniprep Kit and sequenced by Eton Bioscience (San Diego, CA).
-
bioRxiv - Cancer Biology 2023Quote: Lactate in spent growth media was determined employing the L-lactate Assay Kit I from Eton Biosciences (#120001400A, San Diego, CA). Sample lactate analysis was performed in the 96-will plate format with comparison to a standard curve in the range of 30 – 3000uM ...