Labshake search

Citations for Eton Bioscience :

1 - 3 of 3 citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019

Citations are collected from bioRxiv only, the total number of publications could be much larger.

Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosome

Midori Ohta, et al., bioRxiv - Cell Biology 2020

Quote: ... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
Drosophila Rif1 is critical for repair following P-element excision and influences pathway choice at double-strand breaks

Justin R. Blanch, et al., bioRxiv - Genetics 2022

Quote: ... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
Cardiac Troponin I Directly Binds and Inhibits Mitochondrial ATP Synthase: a Noncanonical Role in the Post-Ischemic Heart

Aly Elezaby, et al., bioRxiv - Cell Biology 2023

Quote: ... Serum lactate dehydrogenase level was measured at 3 days after MI by commercially available kit following manufacturer’s instructions (Eton Bioscience, San Diego, CA, USA). Fractional shortening was determined under basal conditions and after isoproterenol stimulation (10μg/kg ...

Feedback