Labshake search
Citations for Eton Bioscience :
1 - 4 of 4 citations for 6 4 OXO 2 THIOXO THIAZOLIDIN 3 YL HEXANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosomebioRxiv - Cell Biology 2020Quote: ... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... Supernatant was used immediately for lactic acid assay to measure secreted lactate in the media using a 1:20 dilution (Cat# 1200011002, Eton Biosciences, San Diego, CA USA). Unconditioned DMEM with 10% FBS was used as a control for subtracting background.
-
bioRxiv - Genetics 2022Quote: ... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
bioRxiv - Cell Biology 2023Quote: ... Serum lactate dehydrogenase level was measured at 3 days after MI by commercially available kit following manufacturer’s instructions (Eton Bioscience, San Diego, CA, USA). Fractional shortening was determined under basal conditions and after isoproterenol stimulation (10μg/kg ...