Labshake search
Citations for Eton Bioscience :
1 - 4 of 4 citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
bioRxiv - Biochemistry 2022Quote: ... Supernatant was used immediately for lactic acid assay to measure secreted lactate in the media using a 1:20 dilution (Cat# 1200011002, Eton Biosciences, San Diego, CA USA). Unconditioned DMEM with 10% FBS was used as a control for subtracting background.
-
bioRxiv - Microbiology 2020Quote: ... sgRNA plasmids were validated by Sanger sequencing using the universal pLKO.1/hU6 promoter primer (Eton Biosciences, San Diego, CA). Lentivirus with sgRNAs were produced and used to transduce low passage FL-Cas9 RAW 264.7 cells ...