Labshake search
Citations for Eton Bioscience :
1 - 5 of 5 citations for 4 Methoxy 2 3 3 4 5 Pentacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosomebioRxiv - Cell Biology 2020Quote: ... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Serum lactate dehydrogenase level was measured at 3 days after MI by commercially available kit following manufacturer’s instructions (Eton Bioscience, San Diego, CA, USA). Fractional shortening was determined under basal conditions and after isoproterenol stimulation (10μg/kg ...
-
bioRxiv - Biochemistry 2019Quote: ... The lysate was immediately mixed with 0.1 M phenylmethanesulfonyl fluoride (PMSF) (50 μl per 10 ml lysate) and 250 units of TurboNuclease (Eton Bioscience), and cleared by centrifugation ...
-
bioRxiv - Synthetic Biology 2019Quote: Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...