Labshake search
Citations for PNA Bio :
1 - 44 of 44 citations for Recombinant Mouse Dickkopf Homolog 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... FAM-tagged TelG probe (PNA Bio F1005) was diluted (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotin-tagged TelC probe (PNA Bio F2001) was diluted (1:200 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (PNA Bio) and sgRNAs were injected at concentrations of 400 ng/µl of Cas9 protein and 100 ng/µl for each sgRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... purified recombinant Cas9 protein (PNA Bio, 300ng/ul) and donor plasmid (500ng/ul ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (900 ng μl−1; PNA Bio, #CP01-20) was co-injected with both sgRNAs (20μM each ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant Cas9 protein containing a nuclear localization signal (PNA Bio Inc) was reconstituted to a solution of 1 mg/mL Cas9 protein in 20 mM HEPES ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
bioRxiv - Bioengineering 2019Quote: ... Synthetic gRNAs (Synthego) and recombinant Streptococcus pyogenes Cas9 protein (PNA Bio Inc.) were obtained commercially and diluted to 1,000 ng/µL in nuclease-free water and stored in aliquots at –80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... before adding recombinant Cas9 protein (300 ng/µL; PNA Bio, CP01-200) for embryo injection.
-
bioRxiv - Immunology 2022Quote: ... Hybridization with 0.5 μg/mL CY-3 (CCCTAA)3 probe (PNA Bio) was carried out in hybridization buffer (10mM Tris pH 7.5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Recombinant Cas9 protein was obtained commercially (PNA Bio Inc., Newbury Park, California, USA). Ribonucleoprotein complexes (RNPs ...
-
bioRxiv - Developmental Biology 2020Quote: ... Recombinant Cas9 protein with NLS sequence (800 ng/μl; PNA Bio, #CP01-20) was co-injected with each gRNA (500ng/μl ...
-
bioRxiv - Neuroscience 2020Quote: ... We directly mixed recombinant Cas9 protein (300 ng/µL; PNA Bio, CP01-200), sgRNA (80 ng/µL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Injection solutions consisted of combinations of Cas9 recombinant protein (PNA Bio, CP-01) 1 μg μl−1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Fertilized eggs of C57BL/6J mice were microinjected with recombinant Cas9 (PNA Bio) and guide RNAs (Synthego ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Cas9 recombinant protein with nuclear localization signal (260 ng/μl; PNA Bio, USA) was co-injected with the gRNA (140ng/µl ...
-
bioRxiv - Neuroscience 2023Quote: ... The CRISPR injection mixture contained 300 ng/µl recombinant Cas9 protein (PNA Bio CP01) and 40 ng/ µl sgRNA (per guide ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 μg of purified recombinant SpCas9 protein (PNA Bio, Inc., Thousand Oaks, CA, USA) was pre-complexed on ice for 20 min with 10 μg of the chemically modified sgRNA (bearing 2’-O methyl phosphorothioate- modified nucleotides at the first 3 and last 3 positions of the synthetic sgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... USA) and 1μl recombinant Cas9 protein (1 μg/μl, PNA Bio, Thousand Oaks, CA, USA) and 2μl RNAse-free water ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl of injection mixture consist of 1 µg of recombinant nls-Cas9 (PNA Bio), 200 ng of purified sgRNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... It includes the Recombinant Cas9 protein with NLS sequence (1500 ng /μl−1; PNA Bio, CP0120) and the sgRNA (750 ng/ μl−1) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Injection solutions consisted of combinations of: 1 μg/μl Cas9 recombinant protein (PNA Bio, CP-01) or 400 ng/μl Cas9 mRNA (Addgene plasmid #51307 (Guo et al. ...
-
bioRxiv - Physiology 2023Quote: Recombinant Cas9 Nuclease and single guide RNA (sgRNA) were purchased from PNA Bio (Thousand Oaks, CA). Targeting oligonucleotide was obtained from IDT (Coralville ...
-
bioRxiv - Developmental Biology 2020Quote: ... the protein Cas9 (recombinant cas protein from S. pyogenes PNA Bio CP01, final concentration 100 ng/μL) and KCL (final concentration 200 mM) ...
-
bioRxiv - Genetics 2021Quote: ... ubi:delta-EGFP was generated by injecting in vitro-transcribed sg RNA and recombinant Cas9 protein (PNA Bio) into ubi:Switch zygotes (Burger et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... dsDNA or ssDNA PCR donors (final concentration 5-10 pg/nL) Cas9 protein tagged with a nuclear localization sequence (PNA Bio CP-01) (final concentration 300-500 pg/nL) ...
-
bioRxiv - Neuroscience 2021Quote: ... sgRNA activity was confirmed by in vitro cleavage assays with purified recombinant Cas9 protein (PNA Bio, Inc., CP01-200) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: dio2vp42rc1 and tbx6vp43rc1 mutant lines were produced by injecting in-vitro transcribed single guide RNAs and recombinant Cas9 protein (PNA Bio) as previously described (Saunders et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 2,000 wild-type Liverpool strain Aedes aegypti embryos were injected with a mix containing recombinant Cas9 protein (PNA Bio, CP01) at 300 ng/µL ...
-
bioRxiv - Developmental Biology 2022Quote: Each injection mix contained 250 ng/µl total of the purified gRNAs and 500 ng/µl of recombinant Cas9 protein (PNA Bio) with 0.2% phenol red in nuclease-free water ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 100 ng of which was used in cleavage assays with 300 ng of recombinant Cas9 (PNA BIO, Thousand Oaks, CA) and 100 ng of each guide RNA upon incubation at 37°C for 1 hour (Figure S5C).
-
bioRxiv - Neuroscience 2022Quote: ... approximately 500 wild-type Aedes aegypti (Liverpool LVP-IB12 strain) embryos were injected with a mixture containing recombinant Cas9 protein (PNA Bio, CP01) at 300 ng/µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Chromosomes were incubated in Tel C Cy 3 PNA probe (PNA Bio) at 83 °C for 5 minutes and allowed to hybridize at room temperature in a dark hybridization chamber for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... coverslips were hybridized with a TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio) to detect telomeric DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... 70% formamide and 0.1 µM Cy3 labeled (CCCTAA)3 PNA probe (PNA Bio, #F1002)) and denatured at 80°C for 3 min in a hybridization oven ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Cancer Biology 2023Quote: ... and incubated with a commercially available Cy3-labeled (CCCTAA)3 peptide nucleic acid probe (PNA Bio) recognizing mammalian telomere sequences ...
-
bioRxiv - Cell Biology 2022Quote: ... Each slide was then covered with hybridising solution containing Cy3-O-O-(CCCTAA)3 probe (PNA bio) in 70% formamide ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
bioRxiv - Cancer Biology 2020Quote: ... following the IF protocol coverslips were denatured and hybridized TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio). Digital images were taken using Zeiss Axio Imager M1 ...
-
bioRxiv - Microbiology 2019Quote: ... FISH was performed using a PNA probe specific to the telomeric sequence (CCCTAA)3 (TelC-Cy5, PNA BIO).
-
bioRxiv - Cancer Biology 2021Quote: ... and then subjected to FISH using a peptide nucleic acid (PNA) probe specific to the telomeric sequence (CCCTAA)3 (TelC-Cy3, PNA BIO). Cells were dehydrated successively in 70% ...
-
bioRxiv - Cancer Biology 2020Quote: ... Coverslips were dehydrated in an ethanol series (70%, 90% and 100%) and hybridized at RT with a TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio) in hybridization buffer (70% formamide ...
-
bioRxiv - Molecular Biology 2022Quote: Selection and synthesis of Cas9 mRNA and sgRNA (5’ AAAATGTGAAATCTCTG-GACAGG-3’) to gp130 target region was provided by PNA Bio (Thousand Oaks, CA) and targeting efficiency of the sgRNAs used for the knock-in experiment was evaluated by surveyor nuclease assay to detect the sgRNA with highest DNA cleavage efficiency ...