Labshake search
Citations for PNA Bio :
1 - 28 of 28 citations for 7H Diimidazo 1 5 a 1 5 4 de quinoxaline 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl of injection mixture consist of 1 µg of recombinant nls-Cas9 (PNA Bio), 200 ng of purified sgRNA ...
-
bioRxiv - Microbiology 2023Quote: ... 1.25 µL of pPNA blocker (5 µM; chloroplast blockers; PNA Bio), 6.5 µL of PCR grade nuclease-free water (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... 1.25 µL of mPNA blocker (5 µM; mitochondria blockers; PNA Bio), 1.25 µL of pPNA blocker (5 µM ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixture was prepared on ice containing 5 µM Cas9 (PNA Bio, CP02), 1 µg/µL sgRNA ...
-
bioRxiv - Genomics 2022Quote: ... The ready to use 5’-Cy3-labeled single strand telomeric probes (TTAGGG)7 (PNA Bio) were purchased from PNAGENE Inc (Daejeon ...
-
bioRxiv - Developmental Biology 2021Quote: ... or with 5 nl or 10 nl of 75pg/nl of sgRNA mixed with 0.2 ng/nl of Cas9 protein (PNA Bio) and 0.1% Texas Red Dextran in 1 cell of 2-cell stage embryos ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg cas9 (PNA Bio) and 500 ng of each sgRNA were incubated on ice for 20 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... dsDNA or ssDNA PCR donors (final concentration 5-10 pg/nL) Cas9 protein tagged with a nuclear localization sequence (PNA Bio CP-01) (final concentration 300-500 pg/nL) ...
-
bioRxiv - Molecular Biology 2022Quote: Selection and synthesis of Cas9 mRNA and sgRNA (5’ AAAATGTGAAATCTCTG-GACAGG-3’) to gp130 target region was provided by PNA Bio (Thousand Oaks, CA) and targeting efficiency of the sgRNAs used for the knock-in experiment was evaluated by surveyor nuclease assay to detect the sgRNA with highest DNA cleavage efficiency ...
-
bioRxiv - Genomics 2020Quote: ... 1 μM mPNA (PNA BIO INC, USA) and DNase/RNase free distilled water (10977-049 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of annealed RNAs was incubated with 1 µL of 10 mg/mL Cas9 protein (PNA Bio # CP01-200) at room temperature (22°C ...
-
bioRxiv - Microbiology 2019Quote: ... 0.375 μl mixed rRNA gene-blocking peptide nucleic acids (PNAs; 1:1 mix of 100 μM plastid PNA and 100 μM mitochondrial PNA; PNA Bio), 0.5 μl Kapa dNTPs ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cas9 (1 mg/ml; CP01-200, PNA Bio Inc) and fresh sgRNA (1 ug ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cas9 (1 mg/ml; CP01-200, PNA Bio Inc) and fresh sgRNA (1 ug ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (900 ng μl−1; PNA Bio, #CP01-20) was co-injected with both sgRNAs (20μM each ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified sgRNA (0.5 µg) was incubated with Cas9 protein (1 µg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Plant Biology 2021Quote: ... and 1 μM blocking primers (mPNA and pPNA, PNA BIO, Inc., Newbury Park, CA). PCR was performed using the following specifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... Telomeric PNA probe was diluted 1:100 (PNA Bio, F1004, TelC-Alexa 488, 3xCCCTAA) in hybridization buffer (70% formamide ...
-
bioRxiv - Neuroscience 2022Quote: ... USA) and 1μl recombinant Cas9 protein (1 μg/μl, PNA Bio, Thousand Oaks, CA, USA) and 2μl RNAse-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were incubated with PNA probes (each 1:1000) TelC-Cy3 (PNA Bio, Cat# F1002) or TelC-AlexaFlour-647 (PNA Bio ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... It includes the Recombinant Cas9 protein with NLS sequence (1500 ng /μl−1; PNA Bio, CP0120) and the sgRNA (750 ng/ μl−1) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Injection solutions consisted of combinations of: 1 μg/μl Cas9 recombinant protein (PNA Bio, CP-01) or 400 ng/μl Cas9 mRNA (Addgene plasmid #51307 (Guo et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Immunology 2020Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio, Newbury Park, CA, USA) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 10 g of each sgRNA (#1 and #2 modified sgRNAs, Synthego) and 15 g Cas9 protein (PNA Bio) and were electroporated using program A23 on the Nucleofector™ 2b Device (Lonza) ...
-
bioRxiv - Developmental Biology 2021Quote: ... mutations we used CRISPR/Cas9 mutagenesis by injecting 1-cell stage embryos with 200 ng/μl T7 sgRNA and 500 ng/μl Cas9 protein (PNA Bio) as described (Shah et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...