Labshake search
Citations for PNA Bio :
1 - 15 of 15 citations for 7 CHLORO 3 METHYL 1H INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
bioRxiv - Immunology 2022Quote: ... Hybridization with 0.5 μg/mL CY-3 (CCCTAA)3 probe (PNA Bio) was carried out in hybridization buffer (10mM Tris pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... The ready to use 5’-Cy3-labeled single strand telomeric probes (TTAGGG)7 (PNA Bio) were purchased from PNAGENE Inc (Daejeon ...
-
bioRxiv - Cancer Biology 2023Quote: ... Chromosomes were incubated in Tel C Cy 3 PNA probe (PNA Bio) at 83 °C for 5 minutes and allowed to hybridize at room temperature in a dark hybridization chamber for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... coverslips were hybridized with a TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio) to detect telomeric DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... 70% formamide and 0.1 µM Cy3 labeled (CCCTAA)3 PNA probe (PNA Bio, #F1002)) and denatured at 80°C for 3 min in a hybridization oven ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Cancer Biology 2023Quote: ... and incubated with a commercially available Cy3-labeled (CCCTAA)3 peptide nucleic acid probe (PNA Bio) recognizing mammalian telomere sequences ...
-
bioRxiv - Cell Biology 2022Quote: ... Each slide was then covered with hybridising solution containing Cy3-O-O-(CCCTAA)3 probe (PNA bio) in 70% formamide ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
bioRxiv - Cancer Biology 2020Quote: ... following the IF protocol coverslips were denatured and hybridized TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio). Digital images were taken using Zeiss Axio Imager M1 ...
-
bioRxiv - Microbiology 2019Quote: ... FISH was performed using a PNA probe specific to the telomeric sequence (CCCTAA)3 (TelC-Cy5, PNA BIO).
-
bioRxiv - Cancer Biology 2021Quote: ... and then subjected to FISH using a peptide nucleic acid (PNA) probe specific to the telomeric sequence (CCCTAA)3 (TelC-Cy3, PNA BIO). Cells were dehydrated successively in 70% ...
-
bioRxiv - Cancer Biology 2020Quote: ... Coverslips were dehydrated in an ethanol series (70%, 90% and 100%) and hybridized at RT with a TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio) in hybridization buffer (70% formamide ...
-
bioRxiv - Molecular Biology 2022Quote: Selection and synthesis of Cas9 mRNA and sgRNA (5’ AAAATGTGAAATCTCTG-GACAGG-3’) to gp130 target region was provided by PNA Bio (Thousand Oaks, CA) and targeting efficiency of the sgRNAs used for the knock-in experiment was evaluated by surveyor nuclease assay to detect the sgRNA with highest DNA cleavage efficiency ...