Labshake search
Citations for PNA Bio :
1 - 9 of 9 citations for 6 ETHYL 4 METHYL PYRAN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
bioRxiv - Developmental Biology 2021Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (Synthego)(Methods Appendix Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... was injected in one-cell stage embryos in a solution containing Nls-CAS9 protein (PNA BIO). The mutagenesis efficacy was evaluated on pools of 30 injected embryos ...
-
bioRxiv - Developmental Biology 2019Quote: ... One nL of injection cocktail (100 pg/nl gRNA and 200 pg/nl Cas9 protein (PNA Bio) in water ...
-
bioRxiv - Developmental Biology 2021Quote: Mutants were generated by injecting one-cell stage embryos with 200 ng/ml sgRNAs and 500 ng/ml Cas9 protein (PNA Bio) using standard procedures (Shah et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... co-injected one-cell stage embryos with RNPs containing 25 pg of gRNA and 500 pg of NLS-Cas9 protein (PNA Bio, Thousand Oaks, CA USA), and raised these fish to adulthood ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
bioRxiv - Genomics 2020Quote: ... Slides were co-denatured for 2 mins at 80°C with TelG-647 (PNA Bio F1014) in hybridization solution (10mM Tris-HCl pH 7.2 ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 10 g of each sgRNA (#1 and #2 modified sgRNAs, Synthego) and 15 g Cas9 protein (PNA Bio) and were electroporated using program A23 on the Nucleofector™ 2b Device (Lonza) ...