Labshake search
Citations for PNA Bio :
1 - 19 of 19 citations for 6 Bromo 4 5 dihydro 1H benzo b azepin 2 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
bioRxiv - Developmental Biology 2021Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (Synthego)(Methods Appendix Fig ...
-
bioRxiv - Genomics 2023Quote: ... Centromeres were labeled with the pan-centromeric probe CENP-B-Cy5 (PNA Bio, F3005). After DNA FISH and CENP-B probe labeling ...
-
bioRxiv - Cell Biology 2021Quote: ... was injected in one-cell stage embryos in a solution containing Nls-CAS9 protein (PNA BIO). The mutagenesis efficacy was evaluated on pools of 30 injected embryos ...
-
bioRxiv - Developmental Biology 2019Quote: ... One nL of injection cocktail (100 pg/nl gRNA and 200 pg/nl Cas9 protein (PNA Bio) in water ...
-
bioRxiv - Cell Biology 2023Quote: ... Probes used for centromere 7 FISH was a Satellite Enumeration Probe from Cytocell (Cat# LPE 007G-A) and for CENP-B box FISH was a PNA probe from PNA Bio with the sequence 5’-ATTCGTTGGAAACGGGA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: Mutants were generated by injecting one-cell stage embryos with 200 ng/ml sgRNAs and 500 ng/ml Cas9 protein (PNA Bio) using standard procedures (Shah et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 1.25 µL of pPNA blocker (5 µM; chloroplast blockers; PNA Bio), 6.5 µL of PCR grade nuclease-free water (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... 1.25 µL of mPNA blocker (5 µM; mitochondria blockers; PNA Bio), 1.25 µL of pPNA blocker (5 µM ...
-
bioRxiv - Developmental Biology 2024Quote: ... co-injected one-cell stage embryos with RNPs containing 25 pg of gRNA and 500 pg of NLS-Cas9 protein (PNA Bio, Thousand Oaks, CA USA), and raised these fish to adulthood ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixture was prepared on ice containing 5 µM Cas9 (PNA Bio, CP02), 1 µg/µL sgRNA ...
-
bioRxiv - Genomics 2022Quote: ... The ready to use 5’-Cy3-labeled single strand telomeric probes (TTAGGG)7 (PNA Bio) were purchased from PNAGENE Inc (Daejeon ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl of injection mixture consist of 1 µg of recombinant nls-Cas9 (PNA Bio), 200 ng of purified sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
bioRxiv - Genomics 2020Quote: ... Slides were co-denatured for 2 mins at 80°C with TelG-647 (PNA Bio F1014) in hybridization solution (10mM Tris-HCl pH 7.2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... or with 5 nl or 10 nl of 75pg/nl of sgRNA mixed with 0.2 ng/nl of Cas9 protein (PNA Bio) and 0.1% Texas Red Dextran in 1 cell of 2-cell stage embryos ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 10 g of each sgRNA (#1 and #2 modified sgRNAs, Synthego) and 15 g Cas9 protein (PNA Bio) and were electroporated using program A23 on the Nucleofector™ 2b Device (Lonza) ...
-
bioRxiv - Developmental Biology 2021Quote: ... dsDNA or ssDNA PCR donors (final concentration 5-10 pg/nL) Cas9 protein tagged with a nuclear localization sequence (PNA Bio CP-01) (final concentration 300-500 pg/nL) ...
-
bioRxiv - Molecular Biology 2022Quote: Selection and synthesis of Cas9 mRNA and sgRNA (5’ AAAATGTGAAATCTCTG-GACAGG-3’) to gp130 target region was provided by PNA Bio (Thousand Oaks, CA) and targeting efficiency of the sgRNAs used for the knock-in experiment was evaluated by surveyor nuclease assay to detect the sgRNA with highest DNA cleavage efficiency ...