Labshake search
Citations for Roche :
1 - 36 of 36 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... tris(hydroxymethyl)aminomethane (Tris hydrochloride, Roche), and sodium chloride (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 300 mM Guanidine Hydrochloride plus cOmplete protease inhibitor (Roche). The cell suspension was lysed using a glass homogenizer followed by sonication (with 8 pulses of 10 second with 70% amplitude sonic vibrations ...
-
bioRxiv - Biochemistry 2023Quote: ... 300 mM Guanidine Hydrochloride) plus cOmplete protease inhibitor (Roche). LeuAC crude extract was then pelleted at 4°C 30 minutes 15K rpm to remove insoluble material ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by reduction and alkylation in 10 mM Tris (2-carboxyethyl) phosphine hydrochloride (Roche) and 55 mM iodo-acetamide (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... The anesthetic was 2:1 Ketamine hydrochloride® (Pfizer, Spain):Diazepam ® (Roche, Spain).
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg/ml AEBSF [4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride] and protease inhibitors cocktail (Complete, Roche). Cells were cracked by multiple passages through a microfluidizer system using a pressure of 18’000 psi ...
-
bioRxiv - Molecular Biology 2023Quote: ... using a LightCycler R 480II (Roche) apparatus.
-
bioRxiv - Developmental Biology 2024Quote: ... digested with proteinase K (RPROTKSOL-R, Roche) post-fixed with 4% PFA ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP)) supplemented with cOmplete™ EDTA-free Protease Inhibitor Cocktail Tablets (Roche) and lysed by sonication ...
-
bioRxiv - Molecular Biology 2024Quote: ... Mitochondria were suspended in 250 µl of sonication buffer (100 mM Tris-HCl pH 7,4; 6 M guanidine hydrochloride, inhibitors of proteases cOmplete Mini (ref. 11836153001, Roche, Indianapolis, IN), inhibitors of phosphatases Phosphatase Inhibitor Cocktail I Liquid (ref ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR data were analyzed using LightCycler R 480 software (Roche). The relative expression levels of the gene of interest (GOI) ...
-
bioRxiv - Cell Biology 2024Quote: ... and a LightCycler® R 96 instrument (Roche Diagnostics, Basel, Switzerland) using specific primer sequences (supplementary Table S1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Urine glucose levels were measured with a COBAS(r) 2000 analyzer (Roche). Blood glucose levels were measured using an “On Call GK dual” glucometer (Robe Medical ...
-
bioRxiv - Biophysics 2021Quote: Cholesterol concentrations were measured calorimetrically using a commercial kit (R-Biopharm and Roche Diagnostics, Cat. No. 10139050035) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... R-5’-GGGACGCAGCAACTGACATT-3’) was assessed by RT-qPCR using SyBR Green solution on a LightCycler480 (Roche). The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... Lactate was quantified using a lactate assay kit (D-Lactic/L-Lactic acid UV method, r-biopharm, Roche). All samples were measured using fresh growth medium as control.
-
bioRxiv - Molecular Biology 2024Quote: ... containing Triton(R) X-100 (Nacalai Tesque, Cat# 35501-15) and cOmplete™ protease inhibitor cocktail (Roche, Cat# 4693116001). After centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... with Triton(R) X-100 (Nacalai Tesque, Cat# 35501-15) and cOmplete™ protease inhibitor cocktail (Roche, Cat# 4693116001). Proteins were isolated from the supernatant ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... The quantity of WSSV genome copies was measured by absolute q-PCR using the primers of WSSV-F/R and a TaqMan fluorogenic probe named TaqMan probe-WSSV via LightCycler TaqMan Master kit (Roche) as described previously (Supplementary Table S2 ...
-
bioRxiv - Neuroscience 2022Quote: ... The coding sequence of full-length hnRNP R was then PCR-amplified from the cDNA using the KAPA HiFi HotStart ReadyMix (Roche) and sub-cloned into pJET1.2 using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Genetics 2024Quote: The entire ∼8kb NR2E3 locus was amplified using NR2E3 F and NR2E3 R primers (Table 1) with the Expand Long Template PCR System (Roche) buffer system 1 ...
-
bioRxiv - Plant Biology 2024Quote: Primer design for RT-qPCR was done using the LightCycler Probe Design Software version 2.0 (1.0.R.36) (Roche, Mannheim, Germany) with default options (Suppl ...
-
bioRxiv - Genomics 2020Quote: ... This was followed with primary antibody incubation performed with 1:1000 goat anti-SOX17 (R&D) diluted with Antibody Dilution Buffer (Roche Ventana) for 60 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 µg of 330-BFP-CYP3A4-enhancer-R-sgRNA were transfected with X-tremeGENE 9 DNA transfection reagent (Roche 6365809001). After 3-5 days ...
-
bioRxiv - Pathology 2022Quote: ... labeling probe (359 bp) was synthesized using primers TiPV-Fq and TiPV-NS1-R (Table 1) and DIG-labeling mix reagent (Roche, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... PCR step 2 was conducted using 10-15ng PCR1 product to complete Illumina sequencing adaptors (P5-dual-index. F and P7-dual-index. R) using Kapa HF Hot Start Ready Mix (Roche, KK2602) with following PCR conditions denaturation - 98°C for 0:45 ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 ng was taken as a template for a PCR reaction (Supplementary Table 4, primers F: 42-65, R: 66-77) using KAPA HiFi HotStart ReadyMix (Roche, KK2602) for adding IIlumina indices and machine adapters ...
-
bioRxiv - Systems Biology 2024Quote: ... equimolar amounts of oligo pool and reverse primer (Supplemental Table 5: Oligo Library cloning R: cttgctatgctgtttccagc) were mixed with 2X KAPA HiFi master mix (Roche, 07958935001) and incubated for 10 min at 72°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the product was used for the second round PCR using the primers F and R-T7 for generating antisense probe and primers R and F-T7 for generating sense probe used in ISH assays with the DIG RNA Labeling Kit (Roche, Mannheim, Germany),the primers were shown in table 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... A 2ml Dounce homogenizer was used to individually homogenize each brain in a 1:1 solution of Lysis-R:2X-RIPA buffer solution with protease inhibitors (Roche cOmplete tablets #11836153001). Each sample was sonicated three times for 7 seconds and then centrifuged at 5000g for 5min at 4°C ...