Labshake search
Citations for Roche :
251 - 300 of 2146 citations for 2 Chloro 3 6 chlorohexanoyl pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized with random primers p(dN)6 (Roche) using SuperScript III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 µl of MNase (1 mg/ml; Nuclease S7, Roche) was added to the lysate ...
-
bioRxiv - Cancer Biology 2023Quote: ... XG1 cells were supplemented with IL-6 (Roche, 3ng/ml).
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Genomics 2024Quote: ... negative selection with 3 μM Ganciclovir (Roche) was carried out for 10 days ...
-
bioRxiv - Genetics 2021Quote: ... and 0.2 μl of glucose-6-phosphate isomerase (PGI, Roche, #10127396001), while another 20 μl was incubated with 980 μl Glucose Reagent (Thermo Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and Hexokinase + Glucose-6-Phosphate dehydrogenase at dilution 1:200 (Roche), for 15 min at 25°C ...
-
bioRxiv - Genomics 2021Quote: ... using 6 ml of FuGENE HD transfection reagent (Roche Diagnostic, USA) in 100ml of OPTIMEM medium (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: Cells were transfected with the appropriate plasmids using Fugene 6 (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and RCAS-Cre using a Fugene 6 transfection kit (Roche, 11814443001) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... at a ratio of 6:1 using lipofectamine (Roche, catalog #6365787001), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... with virus packaging and envelope expressing plasmids using Fugene-6 (Roche). Medium was replaced with DMEM with 10% FCS the next day and supernatant was harvested 3 days post-transfection ...
-
bioRxiv - Immunology 2023Quote: ... T237M or V1092A mutated hALPK1 cDNA constructs using FuGENE 6 (Roche).
-
bioRxiv - Neuroscience 2024Quote: ... The transfection process utilized 6 μl of FuGENE (Roche Applied Science) and 2 μg of various plasmids ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 μl 0.5M EDTA and 1 μl Proteinase K (Roche, 3115828001) were added and the samples were incubated at 45°C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% CHAPS (Roche), supplemented with 2 mM freshly prepared dithiothreitol ...
-
bioRxiv - Cancer Biology 2024Quote: ... (2) trastuzumab (Roche) treatment (10mg/kg ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.2 mM EDTA, 25% glycerol, 0.42 M NaCl, 2 mM beta-mercaptoethanol, 0.01% IGEPAL CA-630, 2× Roche cOmplete protease inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2024Quote: ... knee cartilage was harvested from postnatal day 3-5 mice and treated with 3 mg/ml collagenase D (11088866001, Roche) in DMEM (10569010 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5mM K4Fe(CN)6 and 1 mg/mL of X-gal (Roche) until precipitate was sufficient to visualize ...
-
bioRxiv - Developmental Biology 2020Quote: ... Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche) transfection reagent following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 μM EF-Tu was pre-incubated with 1 mM GTP (Roche) in Reaction Buffer for 5 minutes at 37°C and then was supplemented with 4 μM Val-tRNAVal (all final concentrations) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was stained for 6 min with 0.5 μg/ml DAPI (Roche) and coverslips mounted in Vectashield (Vector H-1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 % Igepal CA630) supplemented with 50 μl 6 x Complete (Roche, 04693132001) and 3 μl protease inhibitor (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: U2OS cells were transfected with the indicated plasmids with Fugene 6 (Roche) according to manufacturer’s instructions using a 3:1 Fugene/plasmid ratio ...
-
bioRxiv - Systems Biology 2024Quote: ... Thereafter 10 µl of hexokinase/ glucose-6-phosphate dehydrogenase (Roche, Mannheim, Germany) was added ...