Labshake search
Citations for Roche :
1601 - 1650 of 2345 citations for 2 Methoxycarbonyl 4 methylthiophene 3 diazonium tetrafluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked with 3% BSA in HBSS buffer for 20 min and incubated with a primary antibody (rat anti-HA, Roche, RD11867423001, 1:100) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled tissue from each brain region was suspended in 6 ml of 0.32 M sucrose homogenization buffer (4 mM HEPES, 0.1 mM CaCl2, 1 mM MgCl2, plus Roche protease inhibitor tablet) and homogenized with a Teflon homogenizer using 10 strokes at 900 rpm ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two milligrams recombinant MYC and 12 μl T7-HCF-1VIC were rotated overnight at 4°C in Kischkel buffer + PIC (Roche 05056489001). Anti-FLAG M2 Affinity Gel (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... The digested DNA was separated in a 1 % agarose gel at 50 Volts for 72 hours at 4°C and transferred to a nylon membrane (Roche®) overnight ...
-
bioRxiv - Biophysics 2022Quote: ... embryos were washed (4 X 10 min) in PBTx and blocked in PBT-B (1× PBS, 20% (v/v) western blocking reagent (Roche, 11921673001), 2 mM ribonucleoside vanadyl complex (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... following a 30 min incubation at 4 °C in the presence of protease inhibitors (cOmplete™ EDTA-free Protease Inhibitor Cocktail, Roche). Following centrifugation at 16,000 g for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Genetics 2022Quote: ... 10% of cleared lysate was set aside to serve as input samples and the remainder was incubated at 4°C with anti-GFP antibodies (Roche #11814460001) for 3 h under gentle rotation ...
-
bioRxiv - Pathology 2020Quote: ... Coverslips were incubated overnight at 4 °C with a 1:100 dilution with one of the following primary antibodies: HA (Roche, #867423001), KDEL (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: WB was performed on cell lysates obtained by harvesting cells with lysis buffer (Tris 125 mM pH 6.8, 4% sodium dodecyl sulfate, 20% glycerol) with Complete Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and sonicating ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... for 3-4 hours at room temperature followed by overnight incubation at 4°C in anti-DIG-AP Fab fragments (1:5000) (Roche 1093274). Embryos were washed with PBST followed by an alkaline tris buffer ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was then discarded and the pellet was resuspended in 300 µL SDS buffer (4 % SDS, 10 mM EDTA, 25 mM TrisHCl pH 7.5, 1 mM PMSF, 1x Roche protease inhibitor) and incubated at room temp (10 minutes) ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at room temperature and incubated with an appropriate antibody overnight at 4°C: 1:3000 anti-DIG-AP (Roche 11093274910), 1:1000 anti-DIG-POD (Roche 11207733910 ...
-
bioRxiv - Microbiology 2023Quote: ... All steps were performed at 4°C and buffers were all supplemented with protease inhibitor cocktail from Roche (cOmplete tablets, EASYpack). The pellets were washed once in buffer A (50 mM Tris/HCl pH8.0 ...
-
bioRxiv - Cancer Biology 2022Quote: Engineered monoallelic cell pellets (500 million cells/sample) were lysed at 4°C in 1% CHAPS (Roche Diagnostics, cat no. 10810126001) lysis buffer (pH 8.0 ...
-
bioRxiv - Immunology 2022Quote: Purified DNA from mouse fecal pellets or sorted cells was subjected to 16S variable region 4 PCR amplification using barcoded 515F and 806R primers (47) and the KAPA2G Robust HotStart ReadyMix (KAPA Biosystems), with the following cycling conditions ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature and incubated with primary antibodies overnight at 4°C against either HA (1:5000, Roche 12013819001), FLAG (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Cell Biology 2024Quote: ... assay was performed following our previous publication(4, 55) and the instruction of In Situ Cell Death Detection Kit TMR red (Roche, 12156792910). Cells were cultured on coverslips for 36 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Each brain with known weight was homogenized at 4°C using automated homogenizer and with IX RIPA buffer containing protease inhibitor tablet (Roche, Germany). After that the brain lysates were centrifuged at 12,000 rpm for 10 mins ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated overnight at 4°C in 1% goat serum in MABT with 1∶5000 alkaline phosphatase-coupled anti-Digoxigenin antibody (Roche Diagnostics). On the third day ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 ng was taken as a template for a PCR reaction (Supplementary Table 4, primers F: 42-65, R: 66-77) using KAPA HiFi HotStart ReadyMix (Roche, KK2602) for adding IIlumina indices and machine adapters ...
-
bioRxiv - Physiology 2024Quote: ... Blood glucose was measured after 4–5h of food withdrawal in mice using a glucose meter (ACCU-CHECK instant, ROCHE diagnostics). At a predetermined time ...
-
bioRxiv - Genomics 2024Quote: ... PCR amplification of libraries equivalent to 4 pg of DNA was performed with the KAPA HiFi Uracil+ kit (Roche, Cat No.KK2802) and primers having a Y-adaptor sequence with a phosphorothioate bond(* ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.05M Tris HCl pH 7.9, 5μM MgCl2, 5μM CaCl2, 2% SDS supplemented with 1x protease inhibitor cocktail, ROCHE) by sonication on ice ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 M NaCl 1 mM TCEP) supplemented by one protease inhibitor cocktail tablet Complete EDTA-free (Roche) and centrifuged for 30 min at 18,000 g 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol and supplemented with complete EDTA-free cocktail tablets (1 tablet/50ml cells; Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM imidazole and 2 mM β-mercaptoethanol) supplemented with DNaseI (AppliChem) and Complete Protease inhibitor (Roche). After one passage through a French press cell ...
-
bioRxiv - Microbiology 2020Quote: ... Cobas SARS-CoV-2 PCR Test for the Cobas 6800 System (Roche Molecular Systems, Branchburg, NJ, USA) was used to detect the presence of SARS-CoV-2 [11].
-
bioRxiv - Microbiology 2022Quote: All samples were tested with: (1) the Roche Nucleocapsid Elecsys Anti-SARS-Cov-2 (Roche, IND, USA) assay (to confirm eligibility) ...
-
bioRxiv - Genetics 2022Quote: ... The PCR procedure was performed by adding 25μL 2 × KAPA HiFi HotStart Ready Mix (KAPA biosystems, KM2602) with 2.5ul primers of NEB Oligos kit and 2.5ul Illumina universal primers ...