Labshake search
Citations for Roche :
1351 - 1400 of 2418 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... but tested negative on the day of sampling (cobas® SARS-CoV-2 test, Roche diagnostics), and from a healthy individual ...
-
bioRxiv - Neuroscience 2020Quote: ... All the PCR reactions were carried out with Kapa HiFi 2 x mastermix (KK2601, Kapa Biosystems). PCR products were then separated by 2% agarose gel ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µg of each plasmid was combined with Fugene transfection reagent (Roche Applied Science, Mannheim, Germany) at a ratio of 5 µl of transfection reagent to 1 µg DNA in 500 µl of MEM and incubated at room temperature for 30 minutes prior to addition to a 10 cm dish of HEK293 cells at 50% confluence ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos were incubated in 1μg/ml of 4′,6-diamidino-2- 532 phenylindole (Roche, Cat# 10236276001) at RT for 10min and washed in PBS 1x ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM MgCl2) supplemented with 1% Triton-X100 and a mini complete protease inhibitor pill (Roche). Lysates were centrifuged at 20,000 × g for 15 min at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... CD4+ T cells and B cells were activated for 48h with 10U/ml IL-2 (Roche) and 2 μg/ml phytohemagglutinin (PHA ...
-
bioRxiv - Developmental Biology 2022Quote: ... rinsed 2 times for 5 minutes with alkaline phosphatase buffer and stained with NBT/BCIP (Roche) as described previously (Kraus et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2% Triton X-100) supplemented with the Roche complete protease inhibitor cocktail (Roche; catalog #: 4693159001). The homogenates were centrifuged at 800 × g for 10 min at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μg/ml AEBSF [4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride] and protease inhibitors cocktail (Complete, Roche). Cells were cracked by multiple passages through a microfluidizer system using a pressure of 18’000 psi ...
-
bioRxiv - Systems Biology 2021Quote: ... for 2 hours followed by overnight digestion with 1.5 mg/ml collagenase B (Roche Diagnostics, Switzerland) in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Developmental Biology 2020Quote: ... hind limbs were harvested and incubated with 2 Wunsch units of Liberase TM (Sigma/Roche 5401127001) in 2ml Ca2+ ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% Triton X-100 and 2 mM phenylmethylsulfonyl fluoride and Complete Protease Inhibitor cocktail (Roche Diagnostics). 2 µg of the extracted proteins were separated by SDS-PAGE gel and stained with CBB R-250 ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were cultivated in the presence of IL-2 (10 IU/mL, Roche, Basel, Switzerland). Three days after coinfection cells were sorted based on expression of mouse CD48 and mCD24 (BD biosciences ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: 400-600 embryos were homogenized in 2 ml 0.5 % Danieau’s with protease inhibitor cocktail (PIC, Roche) and 1 % (v/v ...
-
Single-cell analysis of shared signatures and transcriptional diversity during zebrafish developmentbioRxiv - Developmental Biology 2023Quote: ... animals in PBST were rocked in 2% blocking buffer (5 g of blocking reagent, Roche, 11096176001) in 1X maleate buffer (150mM maleic acid ...
-
bioRxiv - Pathology 2023Quote: ... The digestion was stopped with 2 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitors (Complete-TM, Roche) followed by centrifugation at 18,000 x g for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... D-Mel (d.mel-2) cells were transfected using X-tremeGene HP DNA transfection reagent (#06366236001, Roche). Two days after transfection ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1% sodium dodecyl sulfate) supplemented with 2% v/v protease inhibitor cocktail (Roche; Catalog #11697498001) and 1% v/v phosphatase inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... the bill-skin preparation was treated for 5 minutes with 2 mg/mL collagenase P (Roche) in Krebs solution containing (in mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... The clarified lysate was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3 h at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT) supplemented with 0.3 mg.mL-1 lysozyme and EDTA-free protease inhibitor cocktail (Roche) prior to pressure-assisted lysis using a French press system ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 mM DTT) supplemented with one tablet cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) and 1 mg/ml lysozyme ...
-
bioRxiv - Cell Biology 2022Quote: ... the retinas were sonicated in 200 μL of 2% SDS containing protease inhibitor mixture (eComplete; Roche) in PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... fixed in 2% PFA diluted in HM supplemented with PhosSTOP (04906837001 Roche, one tablet/10 ml) for 15 hours at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNasin 400 U/ml and RVC 2 mM) supplemented with protease inhibitor (complete EDTA free, Roche). 60 μL of equilibrated Dynabeads Protein G (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... all sections were stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000) to visualize cell nuclei within the aortic tissue ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... CD4+ T cells were cultured in RPMI + IL-2 (final concentration 100 U/mL, Roche, 10799068001), IL-7 (final conc ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was incubated with 2 ml of pre-equilibrated Protein C affinity resin (Roche) for 2h at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 μg) using X-tremeGENE HP (1:2 DNA:reagent ratio) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Biochemistry 2024Quote: ... End point cell proliferation was assayed with ELISA 5-bromo-2′ -deoxyuridine (BrdU) kit from Roche Diagnostics (Sigma– Aldrich) ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5-2 M of urea (depending on the construct) and one protease inhibitor cocktail tablet (Roche). Following sonication on ice (10 min at 40 % power ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were labelled with 4’,6-Deamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000; Roche, #10236276001) for 20 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μg of plasmid was transfected using 2 μL X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: Colony PCR reactions were then performed as follows: 2 µL of KAPA HiFi HotStart ReadyMix (Roche) was assembled with 0.8 µL of 1:10 bacteria dilution ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 2 hours at room temperature and then incubated in anti-DIG-AP (Roche, 1:2000) overnight at 4°C and washed and developed with Fast Blue as described in (King 2013) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Strand-specific RNA libraries were prepared for sequencing (3 - 4 biological replicates/treatment) using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, MA, USA). Poly-A mRNAs were purified from 100 ng of total RNA using poly-T-oligo-magnetic beads (Kapa Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked with 3% BSA in HBSS buffer for 20 min and incubated with a primary antibody (rat anti-HA, Roche, RD11867423001, 1:100) overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... digested with proteinase K (RPROTKSOL-R, Roche) post-fixed with 4% PFA ...
-
bioRxiv - Immunology 2023Quote: ... fatty acid free (Roche, Basel, Switzerland), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich ...