Labshake search
Citations for Roche :
701 - 750 of 3239 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche). After centrifugation at 400g for 5 min at 40C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed with 2% paraformaldehyde/ 2% sucrose for 20 min and stained with DAPI (#10236276001, Roche) to visualize anaphases ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % Triton-X and 5 % blocking reagent (Roche) and rabbit anti-GFP antibody (A11122 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Genetics 2020Quote: ... using 5 µL 2x KAPA mix (Roche, #KK2602), 10 µL cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 µg of RNase A (Roche Diagnostics) were added per µg of sample ...
-
bioRxiv - Physiology 2021Quote: ... midazolam (5 μg/g; Roche, Grenzach-Wyhlen, Germany) and fentanyl (0.05 μg/g ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μl phosphatase inhibitor 10X (Roche, 04906837001). Protein extracts from MCF10A-ER-Src were obtained by incubating cell pellets in Lysis Buffer SDS-Free containing 1% protease inhibitors and 1% phosphatase inhibitors on ice for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM DTT and proteinase inhibitor cocktail (Roche)) at 2ml/g ...
-
bioRxiv - Microbiology 2020Quote: ... 5% glycerol) containing protease inhibitors (Roche, Basel, Switzerland). Total cell lysates (25 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... 10mM NaF) and complete protease inhibitors (5×; Roche). The detergent soluble supernatant fractions were immediately processed for SDS– PAGE and immunoblotting with antibodies.
-
bioRxiv - Plant Biology 2021Quote: ... 5 μl SYBR Green PCR master mix (Roche) and ultrapure water up to 10 μl was used and analyzed using the LightCycler 480 System (Roche) ...
-
bioRxiv - Pathology 2021Quote: ... 5 μl of PCR DIG labelling mix (Roche), 3 μl template DNA ...
-
bioRxiv - Genetics 2020Quote: ... 5 mM EDTA with protease inhibitor cocktail (Roche), incubated at 4 °C for 30 min followed by centrifugation at 14000 rpm for 30 min to collect the supernatant ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM DTT and 1x Protease inhibitor (Roche)) ...
-
bioRxiv - Genetics 2023Quote: ... and 5 µL 2x KAPA HiFi ReadyMix (Roche). The following indexing primers were used (X indicates the positions of the 8 bp indices):
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM magnesium chloride and protease inhibitors (Roche). A FastPrep-24 (MP Bio ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/mL DNAse and protease inhibitors (Roche) and lysed by sonication ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/mL DNAse and protease inhibitors (Roche). Lysate was incubated with 1% N-Dodecyl-β-D-maltoside for 1 hour at 4°C with mixing and then spun down at 20,000g for 20 minutes at 4°C to remove cell debris ...
-
bioRxiv - Neuroscience 2024Quote: ... midazolam (5 mg/kg body weight; Dormicum, Roche) and medetomidine (0.5 mg/kg body weight ...
-
bioRxiv - Cell Biology 2024Quote: ... treated with 5 μg/mL Proteinase K (Roche) and post-fixed in 4% (vol/vol ...
-
bioRxiv - Developmental Biology 2024Quote: ... + 5% SDS + 2x cOmplete protease inhibitor cocktail (Roche). After centrifugation at 14k rpm for 10 min at RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 U/mL deoxyribonuclease I (Roche 1010459001)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and laminin at 5 μg/ml (Roche # 11243217001). Cells were cultured in the presence of differentiation factors for 40 days ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 U/ml dispase II (4942078001, Roche). Hydrogels were seeded at a concentration of 500 cells per 200 μL gel (2.5 cells/μL) ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5 µg/mL DAPI (Cat# 10236276001, Roche).
-
bioRxiv - Immunology 2022Quote: ... including 5% Western Blocking Reagent Solution (#11921673001, Roche) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA with protease inhibitors (11697498001, Roche)) by sonication using TAITEC VP-5S sonicator (output ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... 5 mM EDTA] containing protease inhibitor (Roche, 11836153001) and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Genetics 2022Quote: ... in 5% blocking solution (Roche, cat. no.11096176001) at room temperature overnight ...
-
bioRxiv - Genetics 2023Quote: ... 5 µL KAPA HiFi HotStart ReadyMix (KAPA Biosystems) and 1.8 µL H2O HyPure ...