Labshake search
Citations for Roche :
601 - 650 of 8374 citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... resuspended in lysis buffer (20 mM Tris-HCl, pH 7.5, 300 mM NaCl, 0.5 mM TCEP, 1× Benzonase, 3× protease inhibitor cocktail [Roche cOmplete]), and lysed using a cell disruptor at 1.5 kbar ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 mM NaCl, 2 mM MgAc2, 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]). After 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 mM NaCl; 2 mM MgAc; 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]) per 1 g of cell pellet and incubated for 30 min at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... Follicular membranes were removed from isolated oocytes by collagenase treatment (2 mg ml−1; type 1; Sigma-Aldrich or Collagenase-P from Roche) for 3 hr ...
-
bioRxiv - Cell Biology 2024Quote: ... A total of 2 x 109 cells were harvested and washed with equal volume of cold PBS and resuspended in 1 ml lysis buffer (1 x PBS, supplemented with 1% NP40 and 2 x cOmplete, EDTA-free protease inhibitor cocktail (Roche, 11873580001)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were then mechanically lysed (MagNAlyzer Roche – 6000 rpm, 1 min on, 2 min off) in the presence of 300 uL acid-washed glass beads (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM Tris(2-carboxyethyl)phosphin (TCEP) with complete EDTA-free protease inhibitor cocktail (Roche) and 10 µg/ml DNAseI (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation (17,000 rpm for 1 h at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... diluted 2-fold with PBMC culture media and supplemented with 10% WST-1 reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM PMSF) supplemented with 1 protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Developmental Biology 2023Quote: ... was diluted 1 in 50 in solution consisting of 2 % blocking reagent (Roche ref 11096176001), 1 % goat serum (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... The slides were counterstained with 4,6-diamidino-2-phenylindole (DAPI, 1 μg/ml; Roche, Switzerland) for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/ml SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 0.5% SDS, 0.5% SDO, 1% Triton X-100, 1 mM PMSF, Roche cOmplete Mini Protease Inhibitors 1x), and homogenized (Precellys Evolution ...
-
bioRxiv - Biochemistry 2022Quote: ... The PVDF membrane was blocked with 5% skim milk in TBS for 1 h and incubated with anti-HA-HRP (Roche, 3F10, 1:5000) in 5% milk/TBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/mL SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: GST-tagged CBX8 was purified by re-suspending thawed cell pellets in 30 ml of lysis buffer (1× PBS, 5 mM DTT, 1× EDTA free protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN)) per liter of culture ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked in Blocking Buffer + Maleic Acid (Roche, 11585762001) for at least 3 hours before the anti-DIG antibody was added in a concentration of 1:5000 and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by optional sialic acid removal using 0.02 U sialidase (Roche), prior to in-gel trypsin treatment49 ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Neuroscience 2021Quote: ... 25 nM okadaic acid and a protease inhibitor cocktail tablet (Roche). Soluble and insoluble fractions of total homogenates were obtained as previously described (30) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ethylenediaminetetraacetic acid-free Complete Protease Inhibitor Cocktail (Roche Applied Science). After centrifugation at 20,000[×[g for 30 min at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Detection was accomplished using the DIG Nucleic Acid Detection Kit (Roche). Images were quantified using ImageJ ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM ß-mercaptoethanol (BME)) supplemented with 1 mM phenylmethylsulfonyl fluoride and 10 μg/mL DNase (Roche). The resuspension was processed with an Emulsiflex-C5 homogenizer (Avestin) ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked by incubation in 5% (w/v) milk power or 1 × Western Blocking Reagent (Roche) in Tris-buffered saline and 0.1% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The following primary antibodies were used: GCase (5 µg/mL; hGCase-1/23; mouse monoclonal; Roche [62]); LAMP1 (1:500 ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Immunology 2024Quote: ... intestinal pieces were digested in 5% FBS medium (RPMI) supplemented with 1 mg/ml collagenase D (Roche) and 0.5 mg/ml DNase I (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM Tris–HCl pH 7.4) supplemented with 1% TX-100 and cOmplete protease inhibitor cocktail (Roche) was loaded in reducing and denaturing conditions on NuPAGE (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA (1 μl) was mixed with LightCycler 480 SYBR Green I Master (5 μl, Roche, Basel, Switzerland) and relevant primers (4 μl ...
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Physiology 2021Quote: ... 1:500 goat anti-rabbit (AlexaFlour 488; A-11008) and 1:1000 4′,6-diamidino-2-phenylindole (DAPI; Roche 10236276001; Basel, Switzerland). After secondary incubations ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were stained with secondary antibodies (1:300) for 2 h at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). Cells were mounted with ProLong Diamond Antifade Mountant (Thermo P36970 ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) and de-glycosylated for 3 h at 37 °C with 1 unit of PNGase-F (Roche Applied Science) added per 10 μl volume ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The lymphocytes from the immunized mice were fused with myeloma P3U1 cells at a ratio of 3:1 by mixing in 50% polyethylene glycol (Roche). The fused cells were dispersed in 80 ml of GIT medium (Wako ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were diluted 1:3 in ddH2O on ice in a 45 μL total volume before analysis in the Cobas c111 Analyzer (Roche). The Cobas c111 Analyzer is a platform for clinical chemistry testing of human samples but it can also be used to analyze mouse samples ...