Labshake search
Citations for Roche :
601 - 650 of 7714 citations for 1 2 Chloropyridin 3 yl 3 3 dimethylazetidin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Strand-specific RNA libraries were prepared for sequencing (3 - 4 biological replicates/treatment) using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, MA, USA). Poly-A mRNAs were purified from 100 ng of total RNA using poly-T-oligo-magnetic beads (Kapa Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: Cardiac myofibrils were prepared from left ventricular trabecular strips pre-stretched overnight to a sarcomere length of about 2 µm in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 2 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lumbar vertebrae 1 – 5 were incubated in 2% Collagenase P (Roche, Switzerland) for 30 minutes at 30° C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... pH 7.5) with the addition of 2 mg·ml-1 collagenase (Roche, Indianapolis). Defolliculated oocytes were injected with ENaC cRNAs into the cytosol (25 ng per oocyte in 50 nl of RNase-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... nuclei were stained with 4,6 diamine-2-phenylindole (1:25000, DAPI, Roche) in PBS 1X for 1 minute ...
-
bioRxiv - Microbiology 2024Quote: ... 2) step - 1:0.85 using Kapa HyperPure Beads (Roche, cat. no. 07983298001). Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Biophysics 2023Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Microbiology 2024Quote: ... and protease inhibitor tablets (1 per 2 L culture, Roche, Basel, Switzerland) and lysed via sonication ...
-
bioRxiv - Genomics 2024Quote: ... 1 mM Tris(2-carboxyethyl)phosphine (TCEP) and complete protease inhibitor (Roche)) and added to the oligo-bound magnetic beads for 2 hours at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... then washed twice with Buffer 2 (0.05% w/v Saponin, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Triton X-100, 150 mM NaCl, 10% glycerol, and 2 mM EDTA plus one Complete EDTA-free protease inhibitor tablet [Roche] per 50 ml) for 1 hr ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitors (2 mM activated Na3VO4, 2 mM NaF and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... plates were fixed with 2% paraformaldehyde/ 2% sucrose and stained with DAPI (#10236276001, Roche). Plates were photographed with the IN Cell Analyzer 2200 high content analyzer (GE Healthcare) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% Tween-20] and maintained for 2 hours in 2% blocking reagent (11096176001, Roche) in TNT ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% Blocking reagent (Roche, 11096176001), 0.1% Tween 20 ...
-
bioRxiv - Neuroscience 2020Quote: ... using 2 % blocking reagent (Roche), followed by the detection of the Dig-labelled riboprobe with an anti-DIG Fab fragment conjugated with alkaline phosphatase (1:750 ...
-
bioRxiv - Microbiology 2020Quote: ... 2 U Lactate dehydrogenase (Roche) and 10 µg PGAM was pre-warmed to 30 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% blocking reagent (Roche – 1096176001), 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2× Protease Inhibitor Cocktail (Roche), 2 mM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2% Nutridoma-CS (Roche) for 6 days39 ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM creatine phosphate (Roche), 10 ng μL−1 creatine kinase (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were washed in PBSTr and incubated overnight at 4 °C MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-Fluorescein-POD Fab fragments serum (1:500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated overnight at 4°C in 0.1M malic acid/0.1%-TritonX (MABTr)/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-AP Fab fragments serum (1:5000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were incubated overnight at 4 °C in blocking solution MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-POD Fab fragments serum (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... version 2 (Roche, Basel, Switzerland), with a lower limit of detection of 20 copies/ml of plasma.
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg BSA (Roche Diagnostics) and 1 U Immolase DNA polymerase (Meridian Bioscience ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 PhosSTOP easy Pack (ROCHE), Protease Inhibitor cocktail (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mg DNase I (Roche) and triton X-100 to 1% were added ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... 2% blocking reagent (Roche, #11096176001), 10% heat-inactivated sheep serum (Equitech-Bio ...
-
bioRxiv - Immunology 2023Quote: ... 2 μg/ml Histon (Roche), 1 μg/ml Sm/RNP (GenWay) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mg/mL BSA (Roche), 60 µg/mL catalase (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM creatine phosphate (Roche), 10 µg/ml creatine kinase (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM GTPgS (Roche, 10220647001) and 4 mM MgCl2 in BRB80 was incubated for 5 hours at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 protease inhibitor tablets (Roche), 20 M MG132 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 U/mL Liberase (Roche) and 0.25 U/mL Elastase (E0127 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2% BSA Fraction V (Roche), 1% P/S solution and 50 μM β-mercaptoethanol ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μL of each sample was used for qPCR with 2 × Sybr Green (Roche) and primers for human RPLP2 (housekeeping gene) ...
-
bioRxiv - Microbiology 2022Quote: ... (2) the quantitative Roche Spike Elecsys Anti-SARS-Cov-2 S assay (Roche, IND, USA), which measures spike total antibody concentrations ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...