Labshake search
Citations for Merck :
401 - 450 of 734 citations for 3 3 Bromomethyl phenyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APTS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and fixed for at least 3 h with 70% ethanol (Merck, 100983). Cells were washed with PBS and analyzed by using the Cell Cycle Kit (Luminex Corporation ...
-
bioRxiv - Systems Biology 2023Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument (PFPP-LC/MS/MS) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The gelatinous sack surrounding the eggs was removed by incubation in 3% L-Cysteine (Merck Millipore, USA) while rotated by hand for 15 minutes ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with rabbit-α-pH3Ser10 (1:250 for 3 hours at room temperature; Merck Millipore, Burlington, MA), incubated with goat-α-rabbit-AF568 (1:250 for 45 minutes at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... purified ParB was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex 75 gel filtration column (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mo and PN were then washed in DMEM and placed in 3 μm Boyden chambers (Merck Millipore, France), at the concentration of 0.5 x 106 cells/chamber in 200 µl DMEM ...
-
bioRxiv - Biochemistry 2020Quote: TSEN complexes were mixed to a final concentration of 1 or 3 μM with 4x SYPRO Orange (Merck) stock in 50 mM HEPES-NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... purified ParBΔCTD was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex-200 gel filtration column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... and HPLC separation with a ZIC®-cHILIC column (3 µm, 100 Å, 150 mm × 2.1 mm, Merck) and a similar guard column (20 mm × 2.1 mm ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Systems Biology 2020Quote: Wnt signal inhibitor (CK) stock (2.4–3 mM): CKI-7 dihydrochloride (#C0742-5MG, Merck & Co., Inc., NJ, USA) diluted in distilled water (Otsuka Pharmaceutical Factory ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Immunology 2020Quote: ... rAAVDJ or rAAV6 genome plasmid and Donor plasmid at a 3:1:1 ratio in Polyethylenimine (PEI)(Merck). In total each plate was teransfected with 41,250ng of DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... F2 FLAG-tagged TBP::NveRLR::mCherry and wild-type zygotes were treated with 3% L-Cysteine (Merck Millipore), washed and snap frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µL of sample was carefully spotted onto pre-washed PEI-cellulose TLC plates (Merck Millipore, #105725). The TLC plate was eluted in developing buffer containing 10 mM NH4Cl and 5% acetic acid for 100-140 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the eluate was up-concentrated to 3 ml using an Amicon Ultra 3000 MW centrifugal filter unit (Merck). Concentration assessment with a NanoDrop (∊ = 2980 ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfections of DNA plasmids were carried out with the NanoJuice Transfection Kit (71900-3, Merck, Kenilworth, NJ, USA) or the Avalanche-Everyday Transfection Reagent (EZT-EVDY-1 ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Cell Biology 2022Quote: ... expanding cells were transferred to erythroid differentiation medium (Iscove’s medium with stable glutamine [Merck] containing 3% (v/v) AB serum [Merck] ...
-
bioRxiv - Cell Biology 2022Quote: ... Fibers were washed 3×10 min in PBS and incubated in blocking buffer (1% bovine serum albumin (Merck), 5% goat serum (16210-064 ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was concentrated to ∼500 μL using Amicon Ultra-15 Centrifugal Filter Units (Merck Millipore MWCO 3 kDa). The concentration of proteins was determined using JASCO V730 UV-vis spectrophotometer at 280 nm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Microbiology 2023Quote: Supernatants showing biological activity were concentrated using Amicon Ultra-0.5 centrifugal filters (3 kDa) (Merck KGaA, Darmstadt, Germany) as follows ...
-
bioRxiv - Genetics 2023Quote: ... Supernatant was then transferred to an Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore, no. UFC500396) and centrifuged for 45 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Biochemistry 2023Quote: ... and centrifuging in 10 K (3 K for dA) ultra-centrifugal filters Amicon® (Merck KGaA, Darmstadt, Germany). This process was repeated five times to dialyze the ligand ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pellets were resuspended in 50µl NMR buffer (100 mM sodium phosphate, 500µM Sodium 3-(trimethylsilyl)propionate (TMSP; Merck), 10% D2O ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then washed through three 70μl drops of PBST before being transferred to 50μl drops of blocking 3% BSA (Merck) in PBST for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... washed again twice in TBS and then blocked with 3% BSA (Carl Roth) and 0.1% Tween-20 (Merck) in TBS at RT for 1 h ...
-
bioRxiv - Immunology 2023Quote: Peripheral blood mononuclear cells were thawed in the presence of benzonase (Merck 70746-3, used at 1µl/ml), cells were counted and up to 3 x 106 cells were processed for mass cytometry ...
-
bioRxiv - Molecular Biology 2024Quote: ... animals were transferred to 3 cm NGM agar plates containing 5-Fluorouracil (5-FU) (10 µM) (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Molecular Biology 2024Quote: ... air-dried at RT for 30 min and fixed in Methanol:Acetic acid in a 3:1 ratio (Merck) at 4°C overnight ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Cell Biology 2024Quote: Treatments for the LC3 assay included 3 hours with mTOR inhibitor Torin1 (Merck-Millipore, final concentration 250 nM), Bafilomycin A1 (Sigma ...
-
bioRxiv - Physiology 2024Quote: ... washed in tap water for 3 min and stained with 0.02% Fast Green for 30 seconds (F7252, Merck), followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255 ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was applied to 3 kDa MWCO filters (Amicon Ultra-0.5 Centrifugal Filter; Merck Millipore, Darmstadt, Germany), and centrifuged at 14,000 × g for 45 min at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dialyzed solution was concentrated using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The purity of the purified protein was confirmed by SDS‒PAGE (49) ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...