Labshake search
Citations for Merck :
401 - 450 of 5389 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and 1% PenStrep (Merck). Human SH-SY5Y neuroblastoma cells were cultured in DMEM/F-12 (ThermoFisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% PenStrep (Merck). To induce apoptosis ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % penicillin/streptomycin (Merck), 1 % non- essential amino acids (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % penicillin/streptomycin (Merck), 1 % non- essential amino acids (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM KH2PO4 (Merck), 5 mM NaHCO3 (Merck) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM EDTA (Merck), 1% Triton-X100 (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... 1 mM NAC (Merck) and 10 μg/ml DNase (STEMCELL Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM MgSO4 (Merck), 377 µM thiamine (Sigma) ...
-
bioRxiv - Genomics 2024Quote: ... 1 % Penicillin-Streptomycin (Merck MilliporeSigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% glutamine (Merck G7513) and 10% FBS (Biosera 10011500 ...
-
bioRxiv - Cell Biology 2021Quote: ... slides were washed 3×10 min in PBS and counterstained with PI (Merck, 1:500) and p-Phenylenediamine dihydrochloride (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... and 188 μM L-α-phosphatidylcholine: L-α-phosphatidylinositol PC:PI (3:1) (Merck, Darmstadt, DE). 1.5 ml of 0.1 M potassium phosphate buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... at a dilution of 1:1000 in 3% BSA and 0.5% Triton X-100 (Merck) overnight (o/n) ...
-
bioRxiv - Bioengineering 2022Quote: ... The nanobody was reduced using 10 mM Tris(2-carboxyethyl)phosphin -hydrochlorid (TCEP, #51805-45-9, Merck) on ice for 1h ...
-
bioRxiv - Microbiology 2022Quote: ... Ferrets were euthanized by intravenous injection of 1 ml of Beuthanasia-D diluted 1:1 with DI water (Merck, Madison, NJ). For determination of ferret ID50 ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections were blocked with 5% normal donkey serum for 1 h at room temperature and incubated with primary antibodies (rabbit anti-GFAP 1:200, Dako; goat anti-Iba1, 1:500 Wako; NeuroTrace™ 1:200, Thermo Fischer; mouse anti-NeuN Antibody 1:500, Merck, #MAB377 ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured in LHC9/RPMI 1640 (1:1) without serum as previously described51,52 supplemented with rho-associated protein kinase 1 inhibitor (Y-27632, Merck, 5 mM), SMAD-signaling inhibitors ...
-
bioRxiv - Genetics 2023Quote: ... after adding 2 g activated (i.e., baked at 300°C for 2h) molecular sieves (5Å, 45-60 mesh size, Merck, KGaA, Darmstadt, Germany). The molecular sieves were filtered out by loading the extract into a glass funnel (50 mm inner diameter ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, #10236276001, Merck) staining ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Merck cat# D9542) was added to a final concentration of 1 μg/ml to each sample and was used to identify viable cells for analysis ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-β-tubulin (1:1000; clone KMX-1; Merck Millipore, Massachusetts, USA), mouse anti-acetylated α Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated for 1 hour with mEM48 (1:500, Merck Millipore, MAB5374) antibody at room temperature in TBS containing 0.1% TritonX-100 (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-acetylated α-tubulin (clone 6-11B-1, Merck; ExM, 1:250), mouse anti-acetylated α-tubulin (T7451 ...
-
bioRxiv - Immunology 2023Quote: ... were either immersed in a 1:1 mixture of 30% hydrogen peroxide (Merck) and concentrated sulfuric acid (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:500 dilution and nuclear stain DAPI (1 μg/ml, Merck, D9542) at 4°C with gentle rocking ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-DNA Ligase 1 (Sigma Aldrich, Merck, clone 5H5, MABE1905; 1:500); mouse anti-PARP1 (R&D Systems ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-γ-H2AX (Merck, 05-636, 1 mg/ml, dilution 1:1000). For the secondary antibodies ...
-
bioRxiv - Bioengineering 2024Quote: ... Part 1 of the precursor solution contained 20 mg mL-1 fibrinogen (Merck) diluted in DMEM/F12 with HEPES ...
-
bioRxiv - Developmental Biology 2023Quote: ... they were incubated in 100 μg/mL DNAse 1 (1 mg/mL, Merck) in a concentration of 1000 cells/μL for 15 mins at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:2000 and/or DAPI (at 1:1000, ready-made solution, Merck).
-
bioRxiv - Neuroscience 2022Quote: ... and mouse monoclonal anti-NUCB2/nesfatin-1 antibody (1:50; Merck Millipore, MABS1164), and b ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Bioengineering 2023Quote: Two lipids (18:1-18:0 PC, 18:0-18:1 PC) (Merck) and stored at -20°C until sample preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μl polybrene (Merck, TR-1003-G, stock solution at 1 mg/ml) and 1 μl Y-27362 (Calbiochem ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa S3 Flp-In host cells were co-transfected with pEF5/FRT/CTLA4-HA and pOG44 at a ratio of 1:9 using GeneJuice (Merck Millipore, 70967) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were pre-treated with (1) 36 µl of Lysozyme [1% w/v in 1% PBS – 37°C/30min with intermittent shaking] (Merck KGaA, Germany) and then with (2 ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were incubated for 1 hour with 1% BSA blocking solution containing DAPI at 1:4,500 (Merck Life Sciences, Cat #: D9542), phalloidin at 1:350 (Merck Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: Small and large intestines were dissected from E14 embryos and digested with 1 mg/ml DNAse 1 (AppliChem A3778) and 1 mg/ml collagenase A (Merck Millipore 10103586001) in DMEM-F12 at 37 °C while shaking ...
-
bioRxiv - Physiology 2024Quote: ... Rabbit α-mouse Calmodulin (5μg mL-1, CellSignaling), rabbit α-mouse β-actin (1μg mL-1, CellSignaling) and mouse α-mouse GAPDH (1μg mL-1, Merck/Millipore), goat-α-mouse IRDye 680RD ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 900 µl supernatant was transferred to a new tube and incubated with 25 µl (1/2 * OD in µl) of mouse-anti-FLAG antibody (clone M2, Merck/Sigma-Aldrich #F1804) at 4 °C for 45 min (rocking) ...
-
bioRxiv - Biophysics 2022Quote: ... The PDMS particles were generated by vortex-mixing a solution of 1 g PDMS (10:1 w/w, base/curing agent) dispersed in 10ml of 2%w/v poly(ethylene glycol) monooleate (Merck Chemicals GmbH, Germany) aqueous solution ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated overnight at 4°C with mEM48 (1:500, Merck Millipore, Cat. # MAB5374) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated overnight at 4 °C with primary antibodies (GSX2: rabbit 1:200, Merck-Millipore ABN162 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies were applied overnight at 4°C (monoclonal anti–IdU 1:4000; SAB3701448, Merck). Sections were incubated in biotinylated secondary antibodies (Jackson ImmunoResearch Labs ...
-
bioRxiv - Biochemistry 2024Quote: ... and blocked overnight at 4°C with 1% bovine serum albumin (BSA, Merck, Cat# 7906) in PBS (200 µl per well) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Immunology 2021Quote: ... Enriched HSPC-pDCs were then primed for 1-3 days in RF10 (RPMI-1640 medium (Merck) supplemented with 10% (v/v ...