Labshake search
Citations for Merck :
251 - 300 of 6193 citations for N' 4 Dimethylamino phenyl methyl 5 methyl 1 2 oxazole 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... two custom-made Teflon containers of 5 mm diameter were filled with 10 μl of odor substance (n-amylacetate, AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Neuroscience 2023Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay was used to analyze the cell viability of SH-SY5Y cells ...
-
bioRxiv - Microbiology 2024Quote: ... 2–3 mL of stock solution was applied to preparative TLC plates (glass, Merck, 20x20 cm ...
-
bioRxiv - Cancer Biology 2024Quote: The 3-(4,5-dimethylthiazo1-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Merck Sigma, Burlington, MA) reduction assay was used to quantify cell proliferation ...
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Cancer Biology 2024Quote: ... 2 nM T3 supplement (3,3′,5-triiodo-l-thyronine sodium salt) (Merck), and 100 IU/mL penicillin and 100 µg/mL streptomycin (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Neuroscience 2024Quote: ... IL-10 and TNF-α were quantified in the FN of NL and at 21dpi aged GFAP-IL6Tg and WT mice (n= 4-6/experimental group) using a Milliplex MAP Mouse High Sensitivity kit (#MHSTCMAG-70K; Merck Millipore), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... Grids were then stained with 2% (w/v) uranyl acetate pH 4 (Merck) for 1 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... The nuclei were stained with 4′,6-diamidin-2-phenylindol (DAPI, Merck, Germany).
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (D9542) (all from Merck, Auckland, NZ). See table S2 for antibodies used for immunocytochemistry (ICC).
-
bioRxiv - Biophysics 2020Quote: ... and 1% n-Dodecyl β-maltoside (DDM) (Glycon Biochemicals) / 0.2% cholesteryl hemisuccinate (CHS) (Merck) (w/v ...
-
bioRxiv - Immunology 2024Quote: ... we included αTIM-3+ αPD-1 and used anti-human RSV-IgG4 as an isotype control antibody (5 μg/mL, 60AGK S228P, Merck & Co., Inc., Rahway, NJ, USA). On day six ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Cell Biology 2021Quote: ... were applied for one hour at room temperature and cells were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck G8294; 1:3000) before mounting with Fluoromount™.
-
bioRxiv - Immunology 2021Quote: ... neuraminidase-specific inhibitor DANA was added to a final concentration of 100 μM (N-Acetyl-2,3-dehydro-2-deoxyneuraminic acid, Merck, USA). It was used for 48 h prior stimulus.
-
bioRxiv - Microbiology 2023Quote: ... 1 L of freshly 0.1 µm filter-sterilised seawater (n = 2) was filtered onto a 0.2 µm Sterivex (Merck Pty Ltd) filter and snap-frozen in liquid nitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Immunology 2023Quote: ... 1.25 mM N-acetylcysteine (Merck) and 50 pg/mL mEGF (Peprotech)) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Trimethylamine N-oxide (TMAO) (Merck) and glycine (Carl ROTH) ...
-
bioRxiv - Cell Biology 2022Quote: ... N-acetyl cysteine (A7250, Merck) was prepared in water.
-
bioRxiv - Molecular Biology 2024Quote: ... 1.25mM N-acetylcysteine (Merck Millipore), 50 μg/ml recombinant mouse epidermal growth factor (EGF ...
-
bioRxiv - Genomics 2024Quote: ... Cyclopamine (Merck, Cat. N.: 239803) was added at 1uM concentration every two days from the second day to day 10 of differentiation ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2023Quote: ... slides were incubated for 4 h at 4°C with DAPI (1 µg/mL, Merck) and the following secondary antibodies diluted in blocking buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Developmental Biology 2024Quote: ... grids were post-stained with 2% aqueous uranyl acetate at pH 4 (Merck, Germany) and Reynold’s lead citrate ...