Labshake search
Citations for Merck :
251 - 300 of 6423 citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... then post-fixed in 4% PFA (Merck, 8187081000) at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... using RP select B 125-4 Column (Merck). The chromatography was carried out at a flow rate of 1.5ml/min starting with a mobile phase of 80% methanol and 20% H2O for 3 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were fixed with 4% PFA (Merck, #104005) in PBS at room temperature for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... and 0.1 μL Benonase (9025-65-4, Merck) was added to each 1 mL of crude virus extract to remove cell genome and plasmid DNA ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 4 mL of chloroform (Merck Millipore) and mixing ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were then fixed in 4% PFA (Merck) and immunostained with mouse monoclonal anti-SARM1 primary antibody (Chen et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 4% PFA (Merck or Sigma-Aldrich). The brains were collected and fixed overnight in 4% PFA in PBS at 4°C ...
-
bioRxiv - Immunology 2020Quote: Cryosections were fixed with 4% paraformaldehyde (PFA, Merck) and stained with primary and fluorescent-labeled secondary antibodies as described (Figel et al. ...
-
bioRxiv - Genomics 2020Quote: ... filters were fixed with 4% paraformaldehyde (PFA, Merck) and permeabilized with 0.1% Triton X-100 (Merck) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 4% paraformaldehyde (Merck, Whitehouse Station, USA) in 0.1 M PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... and tamoxifen (1uM 4-hydroxy-tamoxifen, Merck, Australia) treatments ...
-
bioRxiv - Cell Biology 2020Quote: Cells were fixed with 4% PFA (1.04005.1000, MERCK), 4% sucrose and 0.1 M phosphate buffer (pH 7.2 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 °C in 10 kDa Amicon (Merck Millipore) filters ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... Treatments were performed with hydroxyurea (4 mM, Merck), the MRE11 inhibitor mirin (25 µM ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 µM SU5402 (both from Merck Life Sciences) and 1 µg/ml doxycycline for 3 days ...
-
bioRxiv - Molecular Biology 2024Quote: ... intracellular parasites were fixed in 4% formaldehyde (Merck) and 0.0075% glutaraldehyde in 1X PBS for 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... using Amicon Ultra-4 filter units (# UFC8100, Merck) with a 100 kDa MWCO membrane ...
-
bioRxiv - Cancer Biology 2022Quote: ... fixed overnight in 4% (v/v) formaldehyde (Merck) in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... the preparations were fixed with 4% formaldehyde (Merck) 1.5–2 h after the addition of the sporozoites ...
-
bioRxiv - Microbiology 2022Quote: ... Coverslips were mounted using Mowiol 4-88 (Merck) containing 200 nM 4′,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-hydroxytamoxifen (70 μL, 100 nM; Merck Millipore) was delivered under general anaesthesia via a single injection into the colonic submucosa via colonoscopy as described by Roper et al.34 ...
-
bioRxiv - Molecular Biology 2024Quote: ... intracellular parasites were fixed with 4% formaldehyde (Merck) and 0.0075% glutaraldehyde (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... samples were fixed in 4% paraformaldehyde (Merck, Belgium) for 24 hours ...
-
bioRxiv - Microbiology 2024Quote: ... 4 U LDH (rabbit muscle, (Merck, Darmstadt, Germany)) and 1.25 µg/ml of Saci_0893 in 50 mM TRIS/HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... Slides were mounted using Mowiol 4-88 (Merck) and images were acquired using an SP8 confocal microscope (Leica ...
-
bioRxiv - Neuroscience 2024Quote: ... Slides were mounted with Mowiol 4–88 (Merck) and images acquired with a Zeiss Axio Imager A2 fluorescence microscope ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μL of substrate solution (4-MUG; Merck) was mixed with 95 μL of GUS extraction buffer and preheated for 2 min at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... or Sigma 4-16KS centrifuge (Merck, Darmstadt, Germany) under inert atmosphere ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 1.8×10-4 M adenine (Merck), 10% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 4 mM L-glutamine (Merck, Cat.G7513, Germany) with or without S100A8 or S100A8/9 recombinant protein (5 or 10 µg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... rings were fixed in 4% PFA (Merck, 16005) for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 mg/mL dispase (#D4693-1G, Merck) for 1 h at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and fixed with 4% formaldehyde (Merck, Darmstadt, Germany) in PBS at room temperature (RT ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked again and incubated overnight at 4°C with DAPI (1:2000) (Merck) and anti-rabbit AlexaFluor-488 (1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The beads were pre-bound with 4-5 micrograms of antibodies (H3K4me3 – Merck 07-473; H3K9me2 Abcam ab1220; H3K27me3 – Acive Motif 39155; H3 – Merck 07-10254; PolII – Abcam ab817) before incubation with the sheared chromatin ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Developmental Biology 2022Quote: ... GHCre/iDTR mice and Cre-negative control littermates (further referred to as -/iDTR) (postnatal day (PD) 4) were intraperitoneally (i.p.) injected with 4 ng diphtheria toxin (DT; Merck, Darmstadt, Germany) per g bodyweight ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were loaded onto self-made 4–13% or 4-10% polyacrylamide gradient gels separated and transferred onto PFDV membranes (Merck Millipore) followed by detection by specific antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... Unencapsulated molecules were removed by washing at least 4 times the LPs suspensions with PBS pH 7.4 for 20 min at 4°C and 5000 x g using an Amicon Ultra-4 concentrator with 100 kDa cutoff (Merck Millipore). The degree of encapsulation was calculated by subtracting from the total mass of the molecule to be encapsulated that present in the flow-through and was found to be higher than 75% in all LP preparations.
-
bioRxiv - Cancer Biology 2024Quote: ... or expressing the sequence of 4-1BBL (Vector Builder, pLV[Exp]-Hygro-EF1A>4-1BBL) using X-tremeGENE™ HP DNA Transfection Reagent (Merck).
-
bioRxiv - Cell Biology 2024Quote: ... Fixed cells were permeabilized with 0.01% saponin (10 min, 4°C) and labeled with Phalloidin-TRITC (Merck, 30 min, 4°C). After washing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Chromatin was pelted at 2000 rcf for 4 mins at 4°C and resuspended in the RIPA buffer (Merck,20-188). The concentration of protein was determined using the Pierce BCA protein assay kit (Thermofisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...