Labshake search
Citations for Merck :
701 - 750 of 2407 citations for 3 Iodo 2 6 dimethyl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... and counterstained with modified Harris Hematoxylin (Epredia) differentiated with 1% acetic acid (Merck) for optimal stain intensity ...
-
bioRxiv - Pathology 2023Quote: ... the slides were washed with acidified water (5 mL glacial acetic acid (Merck) in 11 mL distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... formic acid and IPA in HPLC grade were purchased from Merck (Darmstadt, Germany). Purified water was produced by Elga Purelab Ultra (Celle ...
-
bioRxiv - Cell Biology 2023Quote: ... the pH of milk was adjusted to pH 4.6 by hydrochloric acid (Merck) followed by centrifugation at 4000×rpm (Beckman ...
-
bioRxiv - Microbiology 2023Quote: ... and the protein concentration was determined by bicinchoninic acid (BCA) assay (Merck Millipore) and by UV-visible spectroscopy using an ε of 24 mM⁻¹·cm⁻¹ at 280 nm ...
-
bioRxiv - Cell Biology 2023Quote: ... Released glycans were fluorescently labeled with 8-aminopyrene-1,3,6-trisulfonic acid (APTS, Merck). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... 100 mM ascorbic acid) and filtered through a layer of Miracloth (Merck Millipore) for two times ...
-
bioRxiv - Paleontology 2024Quote: ... and demineralized overnight using 10% HPLC-grade trifluoroacetic acid (TFA) (Merck, Sigma-Aldrich). The CMNF-59632 tusk enamel sample ...
-
bioRxiv - Plant Biology 2024Quote: Seed sections were stained with PAS-NBB: 0.5% (w/v) Periodic Acid (Merck) plus Schiff’s reagent (Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... Trifluoracetic acid (cat# 1.08262.0025) and Triton X-100 (cat#1.12298.0101) were from Merck KGaA (Darmstadt ...
-
bioRxiv - Pathology 2024Quote: ... periodic acid– Schiff staining was performed using a commercial kit (Merck, Darmstadt, Germany). Images were taken using an Axio Imager M1 microscope and the ZEN 3.0 software (Zeiss ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.4 mM L-aspartic acid (Merck/Sigma-Aldrich, CAS number : 56-84-8), 0.1 mM L-cysteine (Merck/Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.55 mM L-glutamic acid (Merck/Sigma-Aldrich, CAS number : 56-86-0), 0.615 mM L-glutamine (Merck/Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... in 1 % acetic acid and counterstaining with 0.04 % Certistain Fast Green (Merck, Germany) in 0.2 % acetic acid.
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Neuroscience 2024Quote: ... The medium was then collected and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243). Five distinct preparations of ACS <3kDa were prepared from five astrocytes cultures and were then sent to the Protein Analysis Facility of the University of Lausanne for Mass Spectrometry analysis.
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein solution was centrifuged at 16,000 g for 30 minutes with a 3 kD cut-off filter (Amicon Ultra Centrifugal Filter, 3 kDa MWCO, Merck Millipore) to remove previous buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µM epoxomicin and 50 µM (Z-LL)2-ketone (Merck Millipore) were added from stock solutions in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000) as liquid medium].
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000), either as liquid medium or supplemented with 2% Agar (Roth ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2% glucose (Merck) along with 2.5% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM CaCl2 (Merck) including sequencing grade trypsin (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Merck, Darmstadt, Germany).
-
bioRxiv - Immunology 2021Quote: ... + 2 μL H2O2 (Merck) in 20 mL citrate buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% Dabco (Merck, D27802) in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM EGTA (Merck), and 5 mM MgCl2 (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% donkey serum (Merck), 0.05% Triton-X-100 (Merck) ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.01% 2-Mercaptoethanol) (Merck) and incubated at 95°C for 10 min following a previously published protocol (Dehesh et al ...
-
bioRxiv - Immunology 2023Quote: ... rotenone (2 μM; Merck) and antimycin A (2 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2) Claret (Merck). The PKH-26 blasts were combined back with the claret LSCs and vice versa ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M MgSO4 (Merck), 670 mM CaCl2 (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M NaCl (Merck), 2 M KCl (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M KCl (Merck), 2 M MgSO4 (Merck) ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM Propionate (Merck), 10 mM Acetate (Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... and Rosetta 2 (Merck) strains were used for overexpression of recombinant proteins.
-
bioRxiv - Cell Biology 2021Quote: ... collagen-grown cells were collected and incubated with ITGA-6 neutralizing antibody (Merck Millipore #MAB1378 ...
-
bioRxiv - Cell Biology 2022Quote: Wound healing assays were performed in Corning® 6-well plates (Merck, UK). HDF and MSC were individually labelled with cell tracking dyes eBioscience™ CFSE (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Respective ELISA kits (insulin, leptin, IL-6 – MilliPlex Map Mouse Adipokine kit, Merck, Germany ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-acetylated α-tubulin (clone 6-11B-1, Merck; ExM, 1:250), mouse anti-acetylated α-tubulin (T7451 ...
-
bioRxiv - Microbiology 2024Quote: ... phage lysates were purified using Vivaspin 6 centrifugal concentrators (MWCO 1,000,000 kDa; Merck). The lysate was washed several times with SM buffer (100 mM NaCl ...
-
bioRxiv - Microbiology 2024Quote: ... containing 6 mg Lysozyme chloride form from chicken egg white (Sigma-Aldrich, Merck) and 1 mg Achromopeptidase (Fujifilm Wako Pure Chemical Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...