Labshake search
Citations for Merck :
451 - 500 of 6557 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... oleic acid and linoleic acid were obtained from Merck, all of them with a purity higher than 97%.
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Cancer Biology 2024Quote: ... 2 nM T3 supplement (3,3′,5-triiodo-l-thyronine sodium salt) (Merck), and 100 IU/mL penicillin and 100 µg/mL streptomycin (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Grids were then stained with 2% (w/v) uranyl acetate pH 4 (Merck) for 1 min ...
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Synthetic Biology 2020Quote: ... nucleic acids were digested by addition of 1 µL benzonase (Merck KGaA) and 10 µL 1 M MgSO4 followed by incubation at room temperature for 10 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... stained with 0.057% Sulforhodamine B solution in 1% acetic acid (Merck, #230162) and washed twice with a 1% acetic acid solution in water ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Gamma-aminobutyric acid (GABA, rabbit, 1:300, Sigma, Merck, Germany, A2052); anti-Green Fluorescent Protein (GFP ...
-
bioRxiv - Immunology 2022Quote: ... and 1 mM ethylendiamine tetraacetic acid (EDTA) (#EDS-100G, Sigma-Aldrich, Merck) in Ca/Mg-free PBS (#14190-169 ...
-
bioRxiv - Cell Biology 2024Quote: ... in 1 % acetic acid and counterstaining with 0.04 % Certistain Fast Green (Merck) in 0.2 % acetic acid.
-
bioRxiv - Cell Biology 2020Quote: ... Nucleoproteins were separated by electrophoresis on 6/12% sodium dodecyl sulfate (SDS) polyacrylamide gels and blotted onto polyvinylidene difluoride (PVDF) membranes (Merck Millipore, Darmstadt, Germany). After blocking for 1 h with 5% bovine serum albumin ...
-
bioRxiv - Neuroscience 2020Quote: Different cellular and mitochondrial parameters of the glutamate- or erastin-induced cell death pathways were analyzed using the Guava easyCyte 6–2L flow cytometer (Merck Millipore, Darmstadt, Germany) upon harvesting adherent HT22 cells and following addition of different fluorescent dyes.
-
bioRxiv - Biophysics 2022Quote: ... equal amounts of GFP and SNAP-tagged recombinant WT-FUS protein (yielding a total protein concentration of 6 μM) were gently mixed into an aqueous solution of 20 % PEG-35 (Merck KGaA, Darmstadt, Germany) and 500 mM KCl (Merck KGaA ...
-
bioRxiv - Cell Biology 2024Quote: ... the qRT-PCR was performed with custom designed Thermo Fisher probes (Supplemenatary table 6) using Universal Sybr Green Master Rox (Merck Life Sciences, 4913850001) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... we included αTIM-3+ αPD-1 and used anti-human RSV-IgG4 as an isotype control antibody (5 μg/mL, 60AGK S228P, Merck & Co., Inc., Rahway, NJ, USA). On day six ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were dissolved in 2% acetonitrile containing 0.1% trifluoroacetic acid and desalted using C18 ZipTips (Merck Millipore, Germany). Each sample was independently analysed on a Q-Exactive hybrid quadrupole-orbitrap mass spectrometer (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... and gentisic acid (2,5-dihydroxybenzoic acid; Merck, Product Number: 841745) was performed in AT minimal medium (86 ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested peptides were acidified by the addition of 5% (v/v) LC-MS grade Formid Acid (FA) (Merck, 5.33002.0050) and purified on C18 columns (Stagetips ...
-
bioRxiv - Biochemistry 2023Quote: ... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose, Merck; 1% soluble starch ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were stopped at each time point using 4 N formic acid and analyzed by PEI-Cellulose-F TLC (Merck) developed in 0.4 M potassium phosphate buffer (pH 3.4) ...
-
bioRxiv - Neuroscience 2023Quote: ... before transcardially perfusing with 21-28 ml of ice-cold PBS and 4%PFA-0,12% picric acid (Merck, Søborg, Denmark). Spleens were excised and weighed ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Microbiology 2020Quote: ... Formic acid (Merck) was added to end the reaction (5% v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Trichloroacetic acid(Merck), Fetal Bovine Serum (Merck ...
-
bioRxiv - Immunology 2023Quote: ... with Ehrlich’s reagent (Sigma)/perchloric acid (Merck) and absorbance was measured at 557 nm ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2023Quote: ... slides were incubated for 4 h at 4°C with DAPI (1 µg/mL, Merck) and the following secondary antibodies diluted in blocking buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...