Labshake search
Citations for Genesee Scientific :
1 - 8 of 8 citations for Recombinant Rat Fc Fragment Of LgG Low Affinity IIb Receptor CD32 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... using low-binding pipette tips (Genesee Scientific) and stored at −80°C before analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... worms were carefully pipetted with low bind tips (Genesee Scientific, cat no. 23-121RS) to NGM plates ...
-
bioRxiv - Genetics 2019Quote: ... HEK293T cells were incubated in high glucose Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% heat inactivated fetal bovine serum (HI FBS, Genesee Scientific), and 1% pen/strep (P/S ...
-
bioRxiv - Cancer Biology 2023Quote: ... we performed qRT-PCR of the cDNA using qPCRBIO SyGreen Blue Mix Hi-ROX (Genesee Scientific; Cat #17-506C) and the Applied Biosystems® ViiATM 7 Real-Time PCR System with 384-well Block (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: sgRNA transduced cells seeded on 6-well plates at ~60% confluency were transfected with 2 μg flag-tagged β2-AR for 48 hr using JetPrime Transfection reagent (Genesee, Cat #55134) following manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: PDX4 SE and PDX4 CR cells were seeded at low density in 48-well plates (20 cells/well; n=24 per plating; 25-108MP; Genesee Scientific) for 10 days ...
-
bioRxiv - Microbiology 2021Quote: ... Colonies of potential recombinant mutants were screened using colony PCR with 2.0 X Taq RED Master Mix (Genesee Scientific, USA). For colony PCR ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...