Labshake search
Citations for Genesee Scientific :
1 - 43 of 43 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... passaging NSCs in conical tubes manufactured by Genesee (15 mL conical tubes, Cat#28-103) resulted in death of the NSC cultures within 1 week of brief exposure to the plastic during passaging ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 30 males and females were selected per test tube (Genesee Scientific, USA) on the nutrient medium with ABE in concentrations 0.1 ...
-
bioRxiv - Genetics 2021Quote: ... and tubes were capped with small foam plugs cut from Droso-Plugs (Genesee Scientific, 59-200). Rather the placing the monitor tubes into an automated monitoring system (Najarro et al ...
-
bioRxiv - Neuroscience 2020Quote: ... we quickly placed the tubes containing the mosquitoes on a CO2 Flypad (Genesee Scientific; cat. # 59-119), so that the hole was directly pressed up against the pad.
-
bioRxiv - Neuroscience 2020Quote: ... Tissue was transferred to a sterile tube containing 300 μl TRI-reagent (Cat.# 11-330T, Genesee Scientific) and homogenized with a mechanical pestle before centrifuging at 13,000 x g for 3 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 270 mg total protein was divided evenly into 11 5-mL centrifuge tubes (Genesee Scientific, 24-285) and rotated with FLAG antibody overnight at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... Droplets were collected at ∼3750 droplets/sec for 30 minutes in 50 mL tubes (Genesee Scientific, #28-106).
-
bioRxiv - Biochemistry 2023Quote: ... Disks for 50 ml RNase-free plastic tubes (part number 28-106, Genesee Scientific, San Diego Ca, USA) were cut to 28.8mm dia ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were incubated at room temperature for 30 minutes in a 2.0 mL screw cap tube (Genesee # 21-265), vortexing every 5 minutes for 15-second pulses ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining 2 ml was transferred to a 5 ml polystyrene round bottomed tube (Genesee Scientific, San Diego, CA) and gently combined with 100 μl of isolation cocktail and 100 μl of RapidSpheresTM (Stem Cell Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... The pellet in each of the six tubes was dissolved in 17.5 μL of DPBS (Genesee Cat. 25-508) by gentle pipetting ...
-
bioRxiv - Physiology 2022Quote: Adult females of each species were individualized in plastic Drosophila tubes (25mm x 95mm, Genesee Scientific, San Diego, CA, USA) and ...
-
bioRxiv - Neuroscience 2021Quote: ... eight groups of flies (four AL and four DR groups) were placed in separate 2.5cm x 20cm tubes (created from three enjoined narrow fly vials [Genesee Scientific]) and dark-adapted for 15-minutes prior to light exposure (no food was available in the vials during phototaxis assays) ...
-
bioRxiv - Microbiology 2024Quote: ... Colonies were inoculated into 3 mL of LB liquid medium contained in 15 mL culture tubes (Genesee Scientific, Morrisville, NC). Cultures were shaken for 24 hours at 250 RPM and 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... an overnight culture was diluted 1/40 into 40 mL of M9 medium with 0.04% glucose but without casamino acids housed in a 50 mL conical tube (Genesee Scientific). The culture was placed in a prewarmed (37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... The generated cDNA was diluted 2x and 1µL was used for PCR amplification using PCR Biosystems VeriFi Mix (Genesee Scientific, 17-308B). A touchdown-PCR method was used for amplification ...
-
bioRxiv - Neuroscience 2019Quote: ... Flies were briefly anesthetized with CO2 and loaded individually in DAMs tubes with standard fly food (Bloomington Formulation, Nutri-fly, #66-113, Genesee Scientific). Sleep was then measured for 12 hr (either 12-hr light or 12-hr dark) ...
-
bioRxiv - Immunology 2023Quote: ... The cell pellet was resuspended in 5 ml of the 70% fraction of a 70:37 Percoll gradient and overlaid on 5 ml of the 37% fraction in a 15 ml Falcon tube (Genesee Scientific). Percoll gradient separation was performed by centrifugation without brakes for 20 minutes at 1500 rpm ...
-
bioRxiv - Developmental Biology 2019Quote: ... Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles) (31) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2019Quote: ... for a total of 15 wells and amplified for 15 PCR cycles using template switching.5 Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles5) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse emulsions droplets were generated at ∼2000 drops/sec and collected in two batches of 15 minutes each in 50 mL tubes (Genesee Scientific, #28-106). After collection ...
-
bioRxiv - Genomics 2019Quote: ... Reverse emulsions droplets were generated at ∼3000 drops/sec and collected in two batches of 20 minutes each in 50 mL tubes (Genesee Scientific, #28-106). After collection ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... The microcapillary tubes were then wrapped in cotton wool and plugged into the top of narrow vials (Genesee Scientific; Product Number: 32-116) containing 3-10 flies on 2% agar in water ...
-
bioRxiv - Genetics 2024Quote: ... Each PCR reaction contained Sybr Green 2X Master Mix (Genesee Scientific), appropriate primer pairs (Figure 1A ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with 12.5μl Apex PCR Master Mix (Genesee Scientific, San Diego, California, USA), nine μl pure water ...
-
bioRxiv - Genetics 2021Quote: ... tubes were placed on their side along the base of a series of cardboard/plastic narrow fly vial trays (Genesee Scientific, 32-124 or 59-163B), with ∼160 tubes per tray ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.5 µL of dNTPs (17-106, PCR Biosystems, Genesee Scientific, El Cajon, CA, USA), 0.75 µL of MgCl2 (42-800B3 ...
-
bioRxiv - Genomics 2022Quote: ... Each 50 μL reaction contained 5 μL of 10X PCR buffer (Genesee, SanDiego, CA), 2.5 μL dNTPs (2 mM per nucleotide) ...
-
bioRxiv - Physiology 2024Quote: ... SYBR Green based real-time PCR was performed using Apex qPCR Master Mix (Genesee Scientific). PCR conditions were as follows ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-time Taqman-PCR was assembled in qPCRBIO Probe Blue Mix (Genesee Scientific Corporation, 17-514) or TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time Taqman-PCR was assembled in qPCRBIO Probe Blue Mix (Genesee Scientific Corporation, 17-514) with 0.5μM of each primer (Forward ...
-
bioRxiv - Cell Biology 2022Quote: ... and stored at -20°C in a sealed 96-well PCR plate (Genesee Scientific, cat#24-302).
-
bioRxiv - Genomics 2021Quote: ... reactions were set up in 10 μl volumes with: 5 μl 2×Apex PCR Master Mix (Genesee Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... sgRNA PCRs were pooled and purified with a Zymo Research DNA Clean and Concentrator kit (Genesee Scientific) and resuspended in 25 μL of Ultra-Pure Water (Genesee) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was subjected to PCR analysis with gene-specific primers in the presence of SyGreen Blue Mix (Genesee). Relative mRNA abundance was obtained by normalization to actin and tubulin housekeeping genes.
-
bioRxiv - Cell Biology 2020Quote: SYBRGreen based real-time PCR was performed using Apex qPCR GREEN Master Mix (Genesee Scientific, San Diego, CA, USA). The experiments were performed as triplicates of at least three independent experiments and are expressed as a ~fold change compared to the control ...
-
bioRxiv - Cancer Biology 2023Quote: ... we performed qRT-PCR of the cDNA using qPCRBIO SyGreen Blue Mix Hi-ROX (Genesee Scientific; Cat #17-506C) and the Applied Biosystems® ViiATM 7 Real-Time PCR System with 384-well Block (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Colonies of potential recombinant mutants were screened using colony PCR with 2.0 X Taq RED Master Mix (Genesee Scientific, USA). For colony PCR ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reaction reagents included 2.5 µL of 10x Buffer (42-800B3, Apex Bioresearch Products, Genesee Scientific, El Cajon, CA, USA), 0.5 µL of dNTPs (17-106 ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was gel purified from a 1.5% Agarose TAE gel using the Zymoclean Gel Extraction Kit (Genesee Scientific). This fragment was then built together with other parts of the pUCP18-GHD vector to obtain the pNLuc10-popD plasmid ...
-
bioRxiv - Neuroscience 2023Quote: Small scale odor exposure for downstream qRT-PCR analysis utilized Drosophila food vials (Catalog #32-117BF, Genesee Scientific, San Diego,CA, USA). Food vials with a cottonball (Catalog # 22-456-883 ...
-
bioRxiv - Genomics 2022Quote: ... We used 2μL of the resulting DNA mixture in a PCR reaction with primers (Left: 5’-CTAGCACGGAACCCTGGAAAT -3’; Right: 5’-GCAGCGCCTAGTAATCACAGA -3’) according to ApexRedTaq (Genesee Scientific, El Cajon, CA) manufacturer instructions ...