Labshake search
Citations for Biotek :
251 - 300 of 679 citations for 2 Ethyl 3 ethyl d5 pyrazine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Microbiology 2021Quote: ... the plate was washed 3 times with 300 uL of supplied wash buffer using a microplate washer (Biotek 405TS). 100 µL of enzyme conjugate was added to the wells and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cellular abundance was read out 72 hours later using the Presto Blue assay (Thermo) on a Cytation 3 (BioTek) plate reader ...
-
bioRxiv - Cell Biology 2021Quote: ... and the emitted light was detected at 510 nm using a Cytation 3 Cell Imaging Multi-Mode Reader (BioTek) at sequential 30-second intervals ...
-
bioRxiv - Microbiology 2022Quote: ... The quality and yield of RNA were analyzed by the Take-3 Plate and Cytation 5 plate reader (BioTek). For the elimination of genomic DNA contamination ...
-
bioRxiv - Microbiology 2021Quote: ... Viability was quantified by fluorescent measurement (Ex. 560 nm, Em. 590 nm) in a Cytation 3 microplate reader (Biotek). Fluorescence values were normalized to DMSO (100% viability ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance at 412 nm (A412) was measured every minute for 30 minutes on a Cytation 3 plate reader (BioTek).
-
bioRxiv - Neuroscience 2023Quote: ... The cells were imaged for GFP fluorescence using an automated Cytation 3 Cell Imaging Reader (BioTek Instruments, Winooski, VT) equipped with a 4x objective ...
-
bioRxiv - Immunology 2024Quote: ... Plates were incubated at 25°C for 1 h then washed 3× in TBST using a plate washer (BioTek). Plates were blocked with 200 μL of 5% non-fat milk in TBST for 1 h at 25°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA in an ODE sample was measured using NanoDrop (Biotek synergy 2). Then RNA concentration was used as a criterion for the amount of DNase (Turbo Dnase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luminescence was detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2020Quote: Growth curves were obtained using an Epoch 2 Microplate Spectrophotometer (Biotek Instruments, Vermont). The plate reader went through 15-min cycles of incubation at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). In vitro growth assays were performed in triplicate with different colonies.
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). Similarly ...
-
bioRxiv - Genomics 2022Quote: ... Growth studies were conducted with the BioTek Synergy™2 system (BioTek Instruments) at 37°C with slow shaking ...
-
bioRxiv - Biochemistry 2022Quote: ... Fluorescence intensities were monitored continuously during substrate hydrolysis on Synergy 2 (BioTek®) plate reader for 120 minutes.
-
bioRxiv - Microbiology 2021Quote: Optical density (OD) measurements were performed with an Epoch 2 plate reader (BioTek) at 37 °C with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Images were acquired 2 days after transfection with Cytation 5 imaging reader (Biotek) GFP and mCherry channels ...
-
bioRxiv - Genetics 2020Quote: ... Infected cell frequencies were quantified by mNeonGreen at 2 dpi (Cytation 5, BioTek). In parallel ...
-
bioRxiv - Microbiology 2023Quote: ... which was recorded over time with an Epoch 2 Microplate Spectrophotometer (BioTek Instruments). All reactions were performed in triplicates of 60 µl each at 25°C in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... The luminescence signal was then measured using a Synergy 2 plate reader (Biotek) according to the manufacturer’s guidelines.e
-
bioRxiv - Biochemistry 2023Quote: ... the fluorescence intensity was measured using a Synergy 2 multimode microplate reader (BioTek) at excitation and emission wavelengths of 360 and 460 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plates were read at 450 nm in a Syngery 2 Plate reader (BioTek).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and grown at 28°C in an Epoch 2 Microplate Spectrophotometer (Agilent BioTek). Absorbance at 600nm (OD600 ...
-
bioRxiv - Cancer Biology 2023Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). Data were normalized to vehicle-only wells.
-
bioRxiv - Cancer Biology 2023Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). For all dose-response curves ...
-
bioRxiv - Microbiology 2022Quote: ... Incubation and OD measurements were performed with an Epoch 2 plate reader (BioTek) at appropriate temperatures with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Cancer Biology 2022Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). For ATP-independent viability assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). Data were normalized to vehicle-only wells.
-
bioRxiv - Cell Biology 2022Quote: ... Absorbance at 600 nm was determined using a Synergy 2 plate reader (BioTek).
-
bioRxiv - Cancer Biology 2024Quote: ... and luminescence detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2024Quote: ... Growth was monitored by measuring A600 every 15min (Epoch 2 or SynergyMx, (Biotek) plate readers) ...
-
bioRxiv - Biochemistry 2024Quote: Peroxidase activity assays were carried out using a Synergy 2 microplate reader (BioTek) at room temperature by following the rate of oxidation of 2,2′-azino bis (3-ethylbenzthiazoline-6-sulfonic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... data acquisition was obtained using a microplate spectrophotometer (Epoch 2; BioTek, Winooski, USA) at wavelengths of 450Lnm ...
-
bioRxiv - Cell Biology 2020Quote: Coelentrazine at a final concentration of 3 μM added per well immediately before reading on a bioluminescence plate reader (Neo2, Biotek) with an integration time of 0.1 s ...
-
bioRxiv - Cancer Biology 2020Quote: ... was added to each well and cells lysed for 10 minutes prior to assessment of absorbance with a Cytation 3 spectrophotometer (BioTek).
-
bioRxiv - Biochemistry 2021Quote: The UV-Vis absorption spectra of the solutions were measured in the beginning of the experiment using either a Cy-tation 3 cell imaging multi-mode reader (BioTek) on a Take3 plate with a 0.5 mm optical path length (2 mM and 200 μM samples) ...
-
bioRxiv - Biochemistry 2021Quote: ... and the absorbance spectrum between 400 and 700 nm was then recorded on a Cytation 3 Cell Imaging Multi-Mode Reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... Images at 0 and 24 h (when fibroblast migration closed the scratch for each group) of post-treatment were captured using a Cytation 3 Cell Imager Multi-Mode Reader (Biotek) and processed using Gen 5.2.0.7 software (Biotek).
-
bioRxiv - Microbiology 2020Quote: ... or human IFN-β (1000 U/ml) and gaussia luciferase activity was determined using Gaussia Luciferase Glow Assay Kit (Thermo) on Cytation 3 (BioTek) multimode plate imager according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... The fluorescence intensity was measured in an experimental setup with excitation at 280 nm and emission at 450 nm with Cytation 3 (BioTek).
-
bioRxiv - Developmental Biology 2021Quote: ... Recordings were performed with the ELx808 Absorbance Microplate Reader and quantified using Gen5 Software Version 3 (both from BioTek Instruments).
-
bioRxiv - Biochemistry 2020Quote: ... 0.05% Tween20) for 1 h at RT and then washed 3 times with H2O and 0.05% Tween20 (BioTek Instruments, EL405). Afterwards ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 hour kinetics were performed at 37°C with either a Cytation 3 a Synergy HTX plate reader (Biotek Instruments) using excitation/emission settings of 485 nm and 528 nm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein quantification was performed using the Pierce BCA protein assay kit (ThermoScientific) and analyzed on a Cytation 3 plate reader (BioTek). Proteins were separated by NuPAGE 4-12% Bis-Tris Gel and transferred to a nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: ... and the absorbance spectrum between 400 and 700 nm was then recorded on a Cytation 3 Cell Imaging Multi-Mode Reader (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... Luminescence values were read using a multi-well luminometer (Cytation 3 Cell Imaging Multi•Mode Reader, BioTek Instruments, Winooski, Vermont).