Labshake search
Citations for Becton, Dickinson and Company :
1 - 15 of 15 citations for pEGFP C2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... CD71 (clone C2) from BD Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP plasmid (BD Biosciences) was transfected into NIH 3T3 fibroblasts using lipofectamine reagent (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... CD71-BV750 (BD Biosciences clone C2), CD8a-BUV737 (BD Biosciences clone 53-6.7) ...
-
bioRxiv - Biophysics 2021Quote: ... pEGFP-N1 (BD Biosciences Clontech, USA) was cotransfected with the channel DNA to visualize successfully transfected cells via their green fluorescence ...
-
bioRxiv - Cancer Biology 2020Quote: ... PE-conjugated anti-mouse CD71 (clone C2; BD), and APC-conjugated anti-mouse Ter119 (clone Ter119 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and anti-CD71 (PE, clone C2, BD Pharmingen). Granulocyte–macrophage maturation was assessed with antibodies anti-CD11b/Mac-1 (APC ...
-
bioRxiv - Neuroscience 2024Quote: ... Developing glutamatergic neurons were transfected with peGFP-N1 (BD Biosciences Clontech) using a calcium phosphate transfection approach ...
-
Nanoscale molecular architecture controls calcium diffusion and ER replenishment in dendritic spinesbioRxiv - Neuroscience 2021Quote: ... In these experiments SP-short subcloned into pEGFP-C1 (BD Biosciences, Clontech) (58 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibodies specific to the following antigens were used in flow cytometry: CD71 (C2/C2F2; BD Biosciences), TER119 (TER-119 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the coding sequence for Map2 was inserted into the backbone of pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The XPack-GFP plasmid was generated by inserting GFP from pEGFP-N1 (BD Biosciences Clontech) into the XPack CMV-XP-MCS-EF1α-Puro Cloning Lentivector (System Biosciences ...
-
bioRxiv - Systems Biology 2021Quote: ... by subcloning the EGFP cassette from pDONR233-eGFP (itself a derivative of pEGFP-C1, BD Biosciences). All the constructs were validated by restriction digest and DNA sequencing of the subcloned fragments.
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... The EGFP+stop cassette was inserted in-frame into exon 1 at the AgeI site following amplification from pEGFP-C1 (BD Biosciences) using primers 2-For and 2-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...