Labshake search
Citations for Avidity :
1 - 29 of 29 citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Avi-tagged Rhesus macaque FcγRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions and tagged with streptavidin-PE ...
-
bioRxiv - Molecular Biology 2021Quote: Biotinylation of SNAP tagged proteins and Avi-tagged proteins were performed as suggested by manufactures (NEB, Avidity). Direct biotinylation of proteins for example-YenB ...
-
bioRxiv - Immunology 2020Quote: ... The Avi-tagged proteins were biotinylated using the BirA enzyme (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... The Avi-tagged proteins were biotinylated using the BirA enzyme (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: BSP-tagged proteins were biotinylated using the BirA biotin-ligase bulk reaction kit (Avidity), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Avi-tagged proteins were biotinylated using the biotinylated by BirA enzymatic reaction (Avidity, Inc) according to the manufacturer’s protocol and purified by SEC ...
-
bioRxiv - Immunology 2021Quote: ... The avi-tagged SARS-CoV-2 RBD antigen was first labeled with biotin (Avidity, BirA500) was subsequently coupled to streptavidin-PE and streptavidin-APC (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... The Protein A resin captured AVI-tagged ZM197-ZM233V1V2 was biotinylated with BirA enzyme (Avidity) and cleaved from the Fc purification tag with HRV3C protease ...
-
bioRxiv - Immunology 2022Quote: ... C-terminally Avi-tagged RBDs were modified with site-specific biotinylation (Avidity, LLC, Aurora, CO) according to the manufacturer’s protocol and immobilized on streptavidin-coated beads (Berkeley Lights ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA trimers were biotinylated by addition of biotin–protein ligase (Avidity). To generate HA tetramers ...
-
bioRxiv - Immunology 2020Quote: ... Avi-tagged HAs were expressed and purified as described above and biotinylated using the Biotin ligase kit (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... avi-tagged proteins were biotinylated with a BirA500 biotin-ligase reaction kit according to the manufacturer’s instruction (Avidity). TT was purchased from Creative Biolabs (Vcar-Lsx003) ...
-
bioRxiv - Immunology 2021Quote: ... the probes were generated by the biotinylation of Avi-tagged SARS-CoV-2 antigens using biotin ligase BirA according to the manufacturer’s instructions (Avidity). Biotin excess was removed by SEC on either a Superdex 200 10/300 column (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 NTD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (Robbiani et al. ...
-
bioRxiv - Immunology 2021Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before 1 ...
-
bioRxiv - Immunology 2020Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... soluble avidin-tagged Gamma S protein was biotinylated with a BIrA500 biotin-ligase reaction kit according to the manufacturer’s instruction (Avidity). Biotinylated protein was then mixed with streptavidin fluorophores (AF647 ...
-
bioRxiv - Microbiology 2019Quote: ... E2mc3 was generated by biotinylation of the individual Avi-tagged HCV E2mc3 using biotin ligase BirA according to the manufacturer’s instructions (Avidity LLC). Biotin excess was removed by SEC on a Superdex 200 column (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2021Quote: ... C-terminal Histidine/Avi-tagged) was obtained from BEI resources (Manassas, VA, USA, Cat. NR53524) and biotinylated using a BirA ubiquitin ligase (Avidity, Aurora, CO, USA, Cat. Bir500A) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2021Quote: To investigate Fc receptor binding recombinant Fc receptors with an AviTag were biotinylated using a Bir500 kit (Avidity, Aurora, CO, USA) according to manufacturer’s instructions and purified using a Zeba Spin Desalting Column ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 μg of BirA (Avidity, LLC), to a final volume of 500 μL buffer [20 mM Tris.HCl pH 7.8 ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 mL of the protein was added to 223 μL Biomix B and 5 μL (5 μg) BirA (both from Avidity) and rocked overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were biotinylated with 5 μg of BirA protein ligase (Avidity) per mg of protein for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... Biotinylation of the AviTag in full-length human FLCN-8xG-AviTag-PreScission-MBP was performed following according to the manufacturer’s (Avidity) suggested protocol and was performed following PreScission protease cleavage and prior to size exclusion chromatography ...
-
bioRxiv - Immunology 2023Quote: ... rhesus macaque FcγR2A and FcγR3A (acquired from the Duke Human Vaccine Institute Protein Production Facility) were biotinylated with a BirA biotin–protein ligase bulk reaction kit (Avidity). C1Q (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Avi-tagged Env proteins at 25 µM were dialyzed into Tris pH8 and incubated for 5 hours with mild agitation at 30 °C using the BirA biotin-protein ligase reaction kit (Avidity LLC), then reconcentrated prior to size-exclusion chromatography ...