Labshake search

1 - 10 of 10 citations for Recombinant Human Lectin Galactoside Binding Soluble 3 since 2019

• Functional and structural modifications of influenza antibodies during pregnancy

  Madeleine F. Jennewein, et al., bioRxiv - Immunology 2021

  Quote: To investigate Fc receptor binding recombinant Fc receptors with an AviTag were biotinylated using a Bir500 kit (Avidity, Aurora, CO, USA) according to manufacturer’s instructions and purified using a Zeba Spin Desalting Column ...
• Isolation of secreted proteins from Drosophila ovaries and embryos through in vivo BirA-mediated biotinylation

  Leslie M. Stevens, et al., bioRxiv - Molecular Biology 2019

  Quote: ... 0.325 μg/μl Maltose Binding Protein (MBP)-AviTag substrate (Avidity, L.L.C.), 8.3 mM ATP and 42 μM biotin ...
• Influenza-specific effector memory B cells predict long-lived antibody responses to vaccination in humans

  Anoma Nellore, et al., bioRxiv - Immunology 2021

  Quote: Recombinant HA trimers were biotinylated by addition of biotin–protein ligase (Avidity). To generate HA tetramers ...
• The pre-existing human antibody repertoire to computationally optimized influenza H1 hemagglutinin vaccines

  Kaito Nagashima, et al., bioRxiv - Immunology 2021

  Quote: ... AviTagged Y2 COBRA HA proteins containing the Y98F mutation to reduce sialic acid binding were biotinylated using the BirA biotin-protein ligase in the BirA500 kit (Avidity) and complexed to streptavidin-fluorophores SA-PE (1:500 dilution ...
• Opposing effects of pre-existing antibody and memory T cell help on the dynamics of recall germinal centers

  Ariën Schiepers, et al., bioRxiv - Immunology 2023

  Quote: ... HAPR8 tetramers for flow cytometry were generated by site-specific biotinylation of non-cysteine-stabilized treated HA protein containing the Y98F mutation that prevents sialic acid binding using BirA-500 ligase (Avidity), followed by Zeba desalting column purification (Thermo Fisher) ...
• Development and applications of sialoglycan-recognizing probes (SGRPs) with defined specificities: exploring the dynamic mammalian sialoglycome

  Saurabh Srivastava, et al., bioRxiv - Molecular Biology 2021

  Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
• COVID-19 mRNA vaccines drive differential Fc-functional profiles in pregnant, lactating, and non-pregnant women

  Caroline Atyeo, et al., bioRxiv - Immunology 2021

  Quote: ... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
• Compartment-Specific Antibody Correlates of Protection to SARS-CoV-2 Omicron in Macaques

  Xin Tong, et al., bioRxiv - Immunology 2024

  Quote: ... Avi-tagged Rhesus macaque FcγRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions and tagged with streptavidin-PE ...
• GABARAP membrane conjugation sequesters the FLCN-FNIP tumor suppressor complex to activate TFEB and lysosomal biogenesis

  Jonathan M. Goodwin, et al., bioRxiv - Cell Biology 2021

  Quote: ... Biotinylation of the AviTag in full-length human FLCN-8xG-AviTag-PreScission-MBP was performed following according to the manufacturer’s (Avidity) suggested protocol and was performed following PreScission protease cleavage and prior to size exclusion chromatography ...
• Humoral correlates of protection against Mycobacterium tuberculosis following intravenous Bacille Calmette-Guérin vaccination in rhesus macaques

  Edward B. Irvine, et al., bioRxiv - Immunology 2023

  Quote: ... rhesus macaque FcγR2A and FcγR3A (acquired from the Duke Human Vaccine Institute Protein Production Facility) were biotinylated with a BirA biotin–protein ligase bulk reaction kit (Avidity). C1Q (Sigma ...