Labshake search
Citations for Avidity :
1 - 3 of 3 citations for L Tyrosine Ring 13C6 99%; 3 3 D2 30% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2022Quote: ... the S-Avitag substrates were diluted to 40 μM and incubated for 1 h at 30℃ with 15 μg/mL BirA enzyme (Avidity) in 0.05 M bicine buffer at pH 8.3 supplemented with 10 mM ATP ...
-
bioRxiv - Immunology 2023Quote: ... Avi-tagged Env proteins at 25 µM were dialyzed into Tris pH8 and incubated for 5 hours with mild agitation at 30 °C using the BirA biotin-protein ligase reaction kit (Avidity LLC), then reconcentrated prior to size-exclusion chromatography ...