Labshake search
Citations for Avidity :
1 - 26 of 26 citations for Human MXRA8 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Env trimers with C-terminal avi-tags (Avidity) were biotinylated and conjugated to streptavidin labeled with different fluorochormes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two complimentary oligonucleotides corresponding to the Avi-tag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA incorporating Hindlll overlapping ends were synthesized (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2023Quote: ... GP was biotinylated by the Avi tag (Avidity, Aurora, Colorado) and exchanged into PBS 7.4.
-
bioRxiv - Immunology 2020Quote: ... were captured using mouse anti-AVI-tag mAb (Avidity LLC, Aurora, CO). In brief ...
-
bioRxiv - Microbiology 2020Quote: ... The RBD with a BirA tag was biotinylated using a biotinylation kit (Avidity, LLC) and was immobilized through the Biotin CAPture Reagent ...
-
bioRxiv - Biophysics 2024Quote: ... and subsequently biotinylated at the C-termini Avi tag sequence via BirA biotin-protein ligase (Avidity) (31) ...
-
bioRxiv - Immunology 2020Quote: All antigens with an Avi tag were biotinylated enzymatically using BirA biotin-protein ligase (Avidity, Bulk BirA) while non-Avi tagged antigens were biotinylated chemically using EZ-Link Sulfo-NHS-Biotin (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... S proteins with Avi-tag were pre-biotinylated using BirA biotin-protein ligase standard reaction kit (Avidity). 25 nM S-614D or 15 nM S-614G in 10X kinetic buffer (ForteBio ...
-
bioRxiv - Bioengineering 2021Quote: ... S1 protein was biotinylated at the AVI-tag using the BirA biotin-protein ligase kit (Avidity Biosciences) and premixed at 5 nM with serial dilutions of VNAR-hFc antibodies for 1 hr at 4°C ...
-
bioRxiv - Biophysics 2023Quote: ... For in in vivo biotinylation on the Avi-tag the plasmid pBirA (Avidity Nanomedicines, La Jolla, CA) was cotransformed and the cell culture procedure was adapted according to Avidity’s in vivo biotinylation protocol.
-
bioRxiv - Neuroscience 2023Quote: The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
bioRxiv - Biophysics 2019Quote: ... was C-terminally equipped with an AVI-tag (GLNDIFEAQKIEWHE) for site-specific biotinylation via the BirA ligase (Avidity) followed by a 3C protease cleavable (LEVLFQGP ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified proteins with an avi-tag were biotinylated by using BirA following the BirA500 kit’s protocol (Avidity, BirA500). Biotinylation was confirmed by performing a Coomassie gel shift assay according to Fairhead and Howarth ...
-
bioRxiv - Immunology 2021Quote: ... trimers used as baits in flow cytometry were expressed with a C-term Avi-tag and biotinylated using a BirA biotinylation kit according to manufacturer’s instructions (Avidity). The BG505 MD39-base KO trimer had the following mutations relative to the BG505 MD39 SOSIP ...
-
bioRxiv - Cell Biology 2022Quote: ... with N-terminal MRGS(H)8 and C-terminal Avi tag was biotinylated in vivo by co-expressing biotin-ligase BirA (pBirAcm from Avidity) in E.coli BL21 (DE3) ...
-
bioRxiv - Immunology 2023Quote: ... featuring an unpaired cysteine residue and C-terminally extended with an AVI-tag (GLNDIFEAQKIEWHE) for site-specific biotinylation with the BirA biotin ligase (Avidity) preceded by a 3C protease recognition site (LEVLFQGP ...
-
bioRxiv - Immunology 2023Quote: Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: Phage display vectors were converted into Fab expression vectors that contain a substrate tag for the biotin ligase BirA (AviTag, Avidity, LLC) at the carboxyl terminus of the heavy chain ...
-
bioRxiv - Immunology 2021Quote: Constructs containing an Avi-tag (ZM197 Env and HA NC99) were biotinylated using the site-specific biotinylation kit according to manufacturer instructions (Avidity LLC.) All other antigens not containing an Avi-tag were non-specifically biotinylated using the EZ-Link Sulfo-NHS-Biotin kit at a 50:1 biotin:protein molar ratio.
-
bioRxiv - Synthetic Biology 2023Quote: Proteins with Avi-tags (GLNDIFEAQKIEWHE; see supplementary materials) were purified as described above and biotinylated in vitro using the BirA500 (Avidity, LLC) biotinylation kit ...
-
bioRxiv - Biophysics 2022Quote: The GPIbα used for kinetic measurements contained an N-terminal Avi-tag which was biotinylated using a BirA biotin-protein ligase kit (Cat #BirA500, Avidity, Aurora, CO). Biolayer interferometry (BLI ...
-
bioRxiv - Immunology 2023Quote: ... competing antibody was diluted to a final concentration of 5 µg/mL in blocking buffer and added to 2 µg/mL GP that was biotinylated through a fused Avi-tag (Avidity, Aurora, Colorado) and incubated for one hour at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Avi-tagged Rhesus macaque FcγRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions and tagged with streptavidin-PE ...
-
bioRxiv - Cell Biology 2021Quote: ... Biotinylation of the AviTag in full-length human FLCN-8xG-AviTag-PreScission-MBP was performed following according to the manufacturer’s (Avidity) suggested protocol and was performed following PreScission protease cleavage and prior to size exclusion chromatography ...
-
bioRxiv - Immunology 2023Quote: ... rhesus macaque FcγR2A and FcγR3A (acquired from the Duke Human Vaccine Institute Protein Production Facility) were biotinylated with a BirA biotin–protein ligase bulk reaction kit (Avidity). C1Q (Sigma ...