Labshake search
Citations for Avidity :
1 - 5 of 5 citations for Histatin 3 HTN3 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2021Quote: ... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Avi-tagged Rhesus macaque FcγRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions and tagged with streptavidin-PE ...
-
bioRxiv - Cell Biology 2021Quote: ... Biotinylation of the AviTag in full-length human FLCN-8xG-AviTag-PreScission-MBP was performed following according to the manufacturer’s (Avidity) suggested protocol and was performed following PreScission protease cleavage and prior to size exclusion chromatography ...
-
bioRxiv - Immunology 2023Quote: ... rhesus macaque FcγR2A and FcγR3A (acquired from the Duke Human Vaccine Institute Protein Production Facility) were biotinylated with a BirA biotin–protein ligase bulk reaction kit (Avidity). C1Q (Sigma ...